Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Serratia proteamaculans 568

Properties
Regulator type: Transcription factor
TF locus tag: Spro_4457
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Enterobacteriales
Statistics of regulated genes:
- Genes 20
- Operons 9
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 65 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -50
Score: 5.8
Sequence: GAGGCGTGATATTATAACATTCG
Locus tag: Spro_2774
Name: znuC
Funciton: high-affinity zinc ABC transporter, ATP-binding protein
Locus tag: Spro_2775
Name: znuB
Funciton: high-affinity zinc ABC transporter, membrane component
znuC
high-affinity zinc ABC transporter, ATP-binding protein
znuB
high-affinity zinc ABC transporter, membrane component

Position: -51
Score: 5.7
Sequence: CGAATGTTATAATATCACGCCTC
Locus tag: Spro_2773
Name: znuA
Funciton: high-affinity zinc ABC transporter, substrate-binding protein
znuA
high-affinity zinc ABC transporter, substrate-binding protein

Position: -36
Score: 6.2
Sequence: TTATTGTTATAGTATAACATTAC
Locus tag: Spro_1125
Name: rpmE2
Funciton: 50S ribosomal protein L31 paralog
Locus tag: Spro_1124
Name: rpmJ2
Funciton: 50S ribosomal protein L36 paralog
rpmE2
50S ribosomal protein L31 paralog
rpmJ2
50S ribosomal protein L36 paralog

Position: -185
Score: 5.8
Sequence: GTGATGTTATAATGTAACACTTA
Locus tag: Spro_1121
Name: znuC2
Funciton: putative zinc ABC transporter, ATP-binding protein
Locus tag: Spro_1122
Name: znuB2
Funciton: putative zinc ABC transporter, membrane protein
Locus tag: Spro_1123
Name: znuA2
Funciton: putative zinc ABC transporter, substrate-binding protein
znuC2
putative zinc ABC transporter, ATP-binding protein
znuB2
putative zinc ABC transporter, membrane protein
znuA2
putative zinc ABC transporter, substrate-binding protein

Position: -69
Score: 5.8
Sequence: GATATGTTATAACATAACAAAAT
Locus tag: Spro_2628
Name: yciA
Funciton: protein of unknown function DUF198
Locus tag: Spro_2627
Name: can2
Funciton: carbonic anhydrase
Locus tag: Spro_2626
Name: yciC
Funciton: Putative zinc chaperone, COG0523 family
yciA
protein of unknown function DUF198
can2
carbonic anhydrase
yciC
Putative zinc chaperone, COG0523 family

Position: -43
Score: 6.5
Sequence: GATATGTTATAATATAACAATTA
Locus tag: Spro_1939
Name: dksA2
Funciton: DnaK suppressor protein
dksA2
DnaK suppressor protein

Position: -85
Score: 6
Sequence: TTATTGTTATGTTATAACATAAC
Position: -80
Score: 5.7
Sequence: GTTATGTTATAACATAACAAAAA
Locus tag: Spro_1297
Name: omr1
Funciton: predicted zinc-related TonB-dependent outer membrane transporter
Locus tag: Spro_1298
Name: znuX
Funciton: predicted zinc-related ABC transporter, periplasmic binding protein
Locus tag: Spro_1299
Name: znuW
Funciton: predicted zinc-related methyltransferase type 12
Locus tag: Spro_1300
Name: znuY
Funciton: predicted zinc-related ABC transporter, permease protein
Locus tag: Spro_1301
Name: null
Funciton: predicted zinc-related ABC transporter, ATP-binding protein
omr1
predicted zinc-related TonB-dependent outer membrane transporter
znuX
predicted zinc-related ABC transporter, periplasmic binding protein
znuW
predicted zinc-related methyltransferase type 12
znuY
predicted zinc-related ABC transporter, permease protein
predicted zinc-related ABC transporter, ATP-binding protein

Position: -3
Score: 5.3
Sequence: TTTATGTTACTTTATAACAATAA
Locus tag: Spro_3632
Name: ECA3248
Funciton: ABC-type uncharacterized transport system, periplasmic component
Locus tag: Spro_3631
Name: ECA3247
Funciton: ABC-type uncharacterized transport system, permease component
ECA3248
ABC-type uncharacterized transport system, periplasmic component
ECA3247
ABC-type uncharacterized transport system, permease component

Position: -47
Score: 5.4
Sequence: GAGATGTTTTGTTATAACGTATC
Locus tag: Spro_3158
Name: CKO_00947
Funciton: hypothetical protein
CKO_00947
hypothetical protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD