Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Proteus mirabilis HI4320

Properties
Regulator type: Transcription factor
TF locus tag: PMI2748
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Enterobacteriales
Statistics of regulated genes:
- Genes 9
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 65 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -47
Score: 6.7
Sequence: GAAATGTTATATTATAACGTTTC
Locus tag: PMI1151
Name: znuC
Funciton: high-affinity zinc ABC transporter, ATP-binding protein
Locus tag: PMI1150
Name: znuB
Funciton: high-affinity zinc ABC transporter, membrane component
znuC
high-affinity zinc ABC transporter, ATP-binding protein
znuB
high-affinity zinc ABC transporter, membrane component

Position: -50
Score: 6.7
Sequence: GAAACGTTATAATATAACATTTC
Locus tag: PMI1152
Name: znuA
Funciton: high-affinity zinc ABC transporter, substrate-binding protein
znuA
high-affinity zinc ABC transporter, substrate-binding protein

Position: -38
Score: 6.5
Sequence: ATATTGTTATATTATAACATTAC
Locus tag: PMI3379
Name: rpmE2
Funciton: 50S ribosomal protein L31 paralog
Locus tag: PMI3380
Name: zinT
Funciton: zinc-binding protein
rpmE2
50S ribosomal protein L31 paralog
zinT
zinc-binding protein

Position: -42
Score: 6.1
Sequence: GTGATGTTATATTATAACAAAAT
Locus tag: PMI1519
Name: ECA3248
Funciton: ABC-type uncharacterized transport system, periplasmic component
Locus tag: PMI1518
Name: ECA3247
Funciton: ABC-type uncharacterized transport system, permease component
ECA3248
ABC-type uncharacterized transport system, periplasmic component
ECA3247
ABC-type uncharacterized transport system, permease component

Position: -23
Score: 5.8
Sequence: GATATGTTATAACATAACAAAAA
Locus tag: PMI2619
Name: omr2
Funciton: predicted zinc-related TonB-dependent outer membrane transporter
Locus tag: PMI2618
Name: omr3
Funciton: predicted zinc-related TonB-dependent outer membrane transporter
omr2
predicted zinc-related TonB-dependent outer membrane transporter
omr3
predicted zinc-related TonB-dependent outer membrane transporter
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD