Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Erwinia carotovora subsp. atroseptica SCRI1043

Properties
Regulator type: Transcription factor
TF locus tag: ECA0632
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Enterobacteriales
Statistics of regulated genes:
- Genes 13
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 65 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -46
Score: 6.4
Sequence: TGTTTGTTATATTATAACATTAC
Locus tag: ECA2485
Name: znuC
Funciton: high-affinity zinc ABC transporter, ATP-binding protein
Locus tag: ECA2486
Name: znuB
Funciton: high-affinity zinc ABC transporter, membrane component
znuC
high-affinity zinc ABC transporter, ATP-binding protein
znuB
high-affinity zinc ABC transporter, membrane component

Position: -53
Score: 6.3
Sequence: GTAATGTTATAATATAACAAACA
Locus tag: ECA2484
Name: znuA
Funciton: high-affinity zinc ABC transporter, substrate-binding protein
znuA
high-affinity zinc ABC transporter, substrate-binding protein

Position: -31
Score: 6
Sequence: GATATGTTATAACATAACAATTG
Locus tag: ECA1168
Name: rpmE2
Funciton: 50S ribosomal protein L31 paralog
Locus tag: ECA1167
Name: rpmJ2
Funciton: 50S ribosomal protein L36 paralog
rpmE2
50S ribosomal protein L31 paralog
rpmJ2
50S ribosomal protein L36 paralog

Position: -123
Score: 6.5
Sequence: GATATGTTATAATATAACAATTA
Locus tag: ECA3756
Name: znuC2
Funciton: putative zinc ABC transporter, ATP-binding protein
Locus tag: ECA3757
Name: znuB2
Funciton: putative zinc ABC transporter, membrane protein
Locus tag: ECA3758
Name: znuA2
Funciton: putative zinc ABC transporter, substrate-binding protein
znuC2
putative zinc ABC transporter, ATP-binding protein
znuB2
putative zinc ABC transporter, membrane protein
znuA2
putative zinc ABC transporter, substrate-binding protein

Position: -3
Score: 5.7
Sequence: ATAATGTTACATTATAACGCTTT
Locus tag: ECA3248
Name: ECA3248
Funciton: ABC-type uncharacterized transport system, periplasmic component
Locus tag: ECA3247
Name: ECA3247
Funciton: ABC-type uncharacterized transport system, permease component
ECA3248
ABC-type uncharacterized transport system, periplasmic component
ECA3247
ABC-type uncharacterized transport system, permease component

Position: -55
Score: 5.4
Sequence: AATTTGGTATGTTATAACATACC
Locus tag: ECA4254
Name: ECA4254
Funciton: predicted zinc-regulated ABC transporter, ATP-binding protein
Locus tag: ECA4255
Name: ECA4255
Funciton: predicted zinc-regulated ABC transporter, periplasmic-binding protein
Locus tag: ECA4256
Name: ECA4256
Funciton: predicted zinc-regulated ABC transporter, permease protein
ECA4254
predicted zinc-regulated ABC transporter, ATP-binding protein
ECA4255
predicted zinc-regulated ABC transporter, periplasmic-binding protein
ECA4256
predicted zinc-regulated ABC transporter, permease protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD