Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Enterobacter sp. 638

Properties
Regulator type: Transcription factor
TF locus tag: Ent638_0250
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Enterobacteriales
Statistics of regulated genes:
- Genes 9
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 65 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -48
Score: 6.2
Sequence: TGGATGTGATATTATAACATTCG
Locus tag: Ent638_2427
Name: znuC
Funciton: high-affinity zinc ABC transporter, ATP-binding protein
Locus tag: Ent638_2428
Name: znuB
Funciton: high-affinity zinc ABC transporter, membrane component
znuC
high-affinity zinc ABC transporter, ATP-binding protein
znuB
high-affinity zinc ABC transporter, membrane component

Position: -52
Score: 6.1
Sequence: CGAATGTTATAATATCACATCCA
Locus tag: Ent638_2426
Name: znuA
Funciton: high-affinity zinc ABC transporter, substrate-binding protein
znuA
high-affinity zinc ABC transporter, substrate-binding protein

Position: -37
Score: 5.6
Sequence: CTTTTGTTATGTTATAACAAAAC
Locus tag: Ent638_0934
Name: rpmE2
Funciton: 50S ribosomal protein L31 paralog
Locus tag: Ent638_0935
Name: rpmJ2
Funciton: 50S ribosomal protein L36 paralog
rpmE2
50S ribosomal protein L31 paralog
rpmJ2
50S ribosomal protein L36 paralog

Position: -53
Score: 6.1
Sequence: GATATGTTATACTATAACATCCT
Locus tag: Ent638_1993
Name: zinT
Funciton: zinc-binding protein
zinT
zinc-binding protein

Position: -140
Score: 5.9
Sequence: TTAGTGTTATGTTATAACATTAT
Locus tag: Ent638_3178
Name: znuC2
Funciton: putative zinc ABC transporter, ATP-binding protein
Locus tag: Ent638_3177
Name: znuB2
Funciton: putative zinc ABC transporter, membrane protein
Locus tag: Ent638_3176
Name: znuA2
Funciton: putative zinc ABC transporter, substrate-binding protein
znuC2
putative zinc ABC transporter, ATP-binding protein
znuB2
putative zinc ABC transporter, membrane protein
znuA2
putative zinc ABC transporter, substrate-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD