Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Citrobacter koseri ATCC BAA-895

Properties
Regulator type: Transcription factor
TF locus tag: CKO_03867
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Enterobacteriales
Statistics of regulated genes:
- Genes 26
- Operons 11
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 65 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -49
Score: 6.7
Sequence: GAAATGTGATATTATAACATTCT
Locus tag: CKO_01105
Name: znuC
Funciton: high-affinity zinc ABC transporter, ATP-binding protein
Locus tag: CKO_01104
Name: znuB
Funciton: high-affinity zinc ABC transporter, membrane component
znuC
high-affinity zinc ABC transporter, ATP-binding protein
znuB
high-affinity zinc ABC transporter, membrane component

Position: -37
Score: 6.6
Sequence: AGAATGTTATAATATCACATTTC
Locus tag: CKO_01106
Name: znuA
Funciton: high-affinity zinc ABC transporter, substrate-binding protein
znuA
high-affinity zinc ABC transporter, substrate-binding protein

Position: -35
Score: 5.5
Sequence: TTATTGTTACGTTATAACATAAT
Locus tag: CKO_02696
Name: rpmE2
Funciton: 50S ribosomal protein L31 paralog
Locus tag: CKO_02695
Name: rpmJ2
Funciton: 50S ribosomal protein L36 paralog
rpmE2
50S ribosomal protein L31 paralog
rpmJ2
50S ribosomal protein L36 paralog

Position: -91
Score: 6.8
Sequence: GTGATGTTATATTATAACATTCC
Locus tag: CKO_01827
Name: zinT
Funciton: zinc-binding protein
zinT
zinc-binding protein

Position: -141
Score: 6.1
Sequence: TTATTGTTATGTTATAACATTTT
Locus tag: CKO_04054
Name: znuC2
Funciton: putative zinc ABC transporter, ATP-binding protein
Locus tag: CKO_04053
Name: znuB2
Funciton: putative zinc ABC transporter, membrane protein
Locus tag: CKO_04052
Name: znuA2
Funciton: putative zinc ABC transporter, substrate-binding protein
znuC2
putative zinc ABC transporter, ATP-binding protein
znuB2
putative zinc ABC transporter, membrane protein
znuA2
putative zinc ABC transporter, substrate-binding protein

Position: -45
Score: 5.7
Sequence: CATTTGTTATGTTATAACGTTAC
Locus tag: CKO_00951
Name: znuC2
Funciton: putative zinc ABC transporter, ATP-binding protein
Locus tag: CKO_00950
Name: znuB2
Funciton: putative zinc ABC transporter, membrane protein
Locus tag: CKO_00949
Name: znuA2
Funciton: putative zinc ABC transporter, substrate-binding protein
znuC2
putative zinc ABC transporter, ATP-binding protein
znuB2
putative zinc ABC transporter, membrane protein
znuA2
putative zinc ABC transporter, substrate-binding protein

Position: -49
Score: 6.2
Sequence: TTAATGTTATGTTATAACGTTTC
Locus tag: CKO_00932
Name: dksA2
Funciton: DnaK suppressor protein
Locus tag: CKO_00933
Name: yciA
Funciton: protein of unknown function DUF198
Locus tag: CKO_00934
Name: can2
Funciton: carbonic anhydrase
dksA2
DnaK suppressor protein
yciA
protein of unknown function DUF198
can2
carbonic anhydrase

Position: -45
Score: 6.3
Sequence: GATATGTTATGTTATAACATATC
Locus tag: CKO_00835
Name: omr1
Funciton: predicted zinc-related TonB-dependent outer membrane transporter
Locus tag: CKO_00834
Name: znuX
Funciton: predicted zinc-related ABC transporter, periplasmic binding protein
Locus tag: CKO_00833
Name: znuW
Funciton: predicted zinc-related methyltransferase type 12
Locus tag: CKO_00832
Name: znuY
Funciton: predicted zinc-related ABC transporter, permease protein
omr1
predicted zinc-related TonB-dependent outer membrane transporter
znuX
predicted zinc-related ABC transporter, periplasmic binding protein
znuW
predicted zinc-related methyltransferase type 12
znuY
predicted zinc-related ABC transporter, permease protein

Position: -29
Score: 6.1
Sequence: TAATTGTTATGATATAACATATC
Locus tag: CKO_00850
Name: ECA4254
Funciton: predicted zinc-regulated ABC transporter, ATP-binding protein
Locus tag: CKO_00851
Name: ECA4255
Funciton: predicted zinc-regulated ABC transporter, periplasmic-binding protein
Locus tag: CKO_00852
Name: ECA4256
Funciton: predicted zinc-regulated ABC transporter, permease protein
ECA4254
predicted zinc-regulated ABC transporter, ATP-binding protein
ECA4255
predicted zinc-regulated ABC transporter, periplasmic-binding protein
ECA4256
predicted zinc-regulated ABC transporter, permease protein

Position: -111
Score: 5.8
Sequence: GTTATGTTATTTTATAACATCCA
Locus tag: CKO_00947
Name: CKO_00947
Funciton: hypothetical protein
CKO_00947
hypothetical protein

Position: -25
Score: 5.6
Sequence: TTATTGTTACGTTATAACATAAC
Locus tag: CKO_00923
Name: hisI2
Funciton: phosphoribosyl-AMP cyclohydrolase
Locus tag: CKO_00924
Name: hisI2
Funciton: phosphoribosyl-AMP cyclohydrolase
Locus tag: CKO_00925
Name: yciC
Funciton: Putative zinc chaperone, COG0523 family
hisI2
phosphoribosyl-AMP cyclohydrolase
hisI2
phosphoribosyl-AMP cyclohydrolase
yciC
Putative zinc chaperone, COG0523 family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD