Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PdhR in Erwinia amylovora ATCC 49946

Properties
Regulator type: Transcription factor
TF locus tag: EAM_0746
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Pyruvate metabolism
Effector: Pyruvate
Regulog: PdhR - Enterobacteriales
Statistics of regulated genes:
- Genes 4
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 44 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -49
Score: 6.6
Sequence: TAAATTGGTATTACCAATTTA
Locus tag: EAM_0746
Name: pdhR
Funciton: Transcriptional repressor for pyruvate dehydrogenase complex, GntR family
Locus tag: EAM_0747
Name: aceE
Funciton: Pyruvate dehydrogenase E1 component (EC 1.2.4.1)
Locus tag: EAM_0748
Name: aceF
Funciton: Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
Locus tag: EAM_0749
Name: lpdA
Funciton: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
pdhR
Transcriptional repressor for pyruvate dehydrogenase complex, GntR family
aceE
Pyruvate dehydrogenase E1 component (EC 1.2.4.1)
aceF
Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
lpdA
Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD