Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PdhR in Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Properties
Regulator type: Transcription factor
TF locus tag: KPN_00117
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Pyruvate metabolism
Effector: Pyruvate
Regulog: PdhR - Enterobacteriales
Statistics of regulated genes:
- Genes 7
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 44 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -49
Score: 6.7
Sequence: TAAATTGGTAAGACCAATTGA
Locus tag: KPN_00117
Name: pdhR
Funciton: Transcriptional repressor for pyruvate dehydrogenase complex, GntR family
Locus tag: KPN_00118
Name: aceE
Funciton: Pyruvate dehydrogenase E1 component (EC 1.2.4.1)
Locus tag: KPN_00119
Name: aceF
Funciton: Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
Locus tag: KPN_00120
Name: lpdA
Funciton: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
pdhR
Transcriptional repressor for pyruvate dehydrogenase complex, GntR family
aceE
Pyruvate dehydrogenase E1 component (EC 1.2.4.1)
aceF
Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
lpdA
Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)

Position: -170
Score: 5.2
Sequence: ATTATTGGTAATACAAATGAA
Locus tag: KPN_00169
Name: hemL
Funciton: Glutamate-1-semialdehyde aminotransferase (EC 5.4.3.8)
hemL
Glutamate-1-semialdehyde aminotransferase (EC 5.4.3.8)

Position: -67
Score: 5.7
Sequence: AACAATGGTTTTACCAATTGG
Locus tag: KPN_02902
Name: yfiD
Funciton: stress-induced alternate pyruvate formate-lyase subunit
yfiD
stress-induced alternate pyruvate formate-lyase subunit

Position: -136
Score: 6.4
Sequence: AATTTTGGTATGACCAATGCA
Locus tag: KPN_01106
Name: ndh
Funciton: NADH dehydrogenase
ndh
NADH dehydrogenase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD