Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PdhR in Proteus mirabilis HI4320

Properties
Regulator type: Transcription factor
TF locus tag: PMI2047
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Pyruvate metabolism
Effector: Pyruvate
Regulog: PdhR - Enterobacteriales
Statistics of regulated genes:
- Genes 6
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 44 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -69
Score: 6.7
Sequence: TAAATTGGTATTACCAATTGA
Locus tag: PMI2047
Name: pdhR
Funciton: Transcriptional repressor for pyruvate dehydrogenase complex, GntR family
Locus tag: PMI2046
Name: aceE
Funciton: Pyruvate dehydrogenase E1 component (EC 1.2.4.1)
Locus tag: PMI2045
Name: aceF
Funciton: Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
Locus tag: PMI2044
Name: lpdA
Funciton: Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)
pdhR
Transcriptional repressor for pyruvate dehydrogenase complex, GntR family
aceE
Pyruvate dehydrogenase E1 component (EC 1.2.4.1)
aceF
Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex (EC 2.3.1.12)
lpdA
Dihydrolipoamide dehydrogenase of pyruvate dehydrogenase complex (EC 1.8.1.4) @ Dihydrolipoamide dehydrogenase (EC 1.8.1.4)

Position: -141
Score: 5.7
Sequence: AACTTTGGTATGACCATATTG
Locus tag: PMI0875
Name: ndh
Funciton: NADH dehydrogenase
ndh
NADH dehydrogenase

Position: -75
Score: 5.7
Sequence: AACATTGGTTAGACCAAATAC
Locus tag: PMI1898
Name: grcA
Funciton: stress-induced alternate pyruvate formate-lyase subunit
grcA
stress-induced alternate pyruvate formate-lyase subunit
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD