Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of IscR in Proteus mirabilis HI4320

Properties
Regulator type: Transcription factor
TF locus tag: PMI1861
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Enterobacteriales
Statistics of regulated genes:
- Genes 9
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 45 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -38
Score: 6.3
Sequence: ATAACCAACCAGAACAGTCAACTAT
Locus tag: PMI2926
Name: nfuA
Funciton: NfuA Fe-S protein maturation
nfuA
NfuA Fe-S protein maturation

Position: -88
Score: 6.2
Sequence: ATACCTGACTAAAACACTCAGATAA
Position: -63
Score: 6.6
Sequence: ATAGTTGACTAAATTACTCAGGAAT
Locus tag: PMI1861
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: PMI1860
Name: iscS
Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Locus tag: PMI1859
Name: iscU
Funciton: Iron-sulfur cluster assembly scaffold protein IscU
Locus tag: PMI1858
Name: iscA
Funciton: Iron binding protein IscA for iron-sulfur cluster assembly
Locus tag: PMI1857
Name: hscB
Funciton: co-chaperone protein HscB
Locus tag: PMI1856
Name: hscA
Funciton: Chaperone protein HscA
Locus tag: PMI1855
Name: fdx
Funciton: ferredoxin, 2Fe-2S type, ISC system
Locus tag: PMI1854
Name: yfhJ
Funciton: putative Fe-S cluster assembly protein
iscR
Iron-sulfur cluster regulator IscR
iscS
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU
Iron-sulfur cluster assembly scaffold protein IscU
iscA
Iron binding protein IscA for iron-sulfur cluster assembly
hscB
co-chaperone protein HscB
hscA
Chaperone protein HscA
fdx
ferredoxin, 2Fe-2S type, ISC system
yfhJ
putative Fe-S cluster assembly protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD