Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of IscR in Erwinia amylovora ATCC 49946

Properties
Regulator type: Transcription factor
TF locus tag: EAM_2493
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Enterobacteriales
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 45 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -37
Score: 6.7
Sequence: ATAACCAACTGAATTAGTCAACTAT
Locus tag: EAM_3259
Name: nfuA
Funciton: NfuA Fe-S protein maturation
nfuA
NfuA Fe-S protein maturation

Position: -138
Score: 4.9
Sequence: ATAGTTGAGTAAATTACCAGGTTAA
Position: -88
Score: 5.9
Sequence: ATACTTGACCAATTTACTCGGGAAT
Locus tag: EAM_2493
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: EAM_2492
Name: iscS
Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscR
Iron-sulfur cluster regulator IscR
iscS
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD