Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AscG in Serratia proteamaculans 568

Properties
Regulator type: Transcription factor
TF locus tag: Spro_0577
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization; Cellobiose utilization
Effector: Cellobiose-6-phosphate; Beta-glucoside-6-phosphate
Regulog: AscG - Enterobacteriales
Statistics of regulated genes:
- Genes 6
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 28 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -99
Score: 4.9
Sequence: CCCTGCAACCGGTTACTGAA
Position: -86
Score: 5.4
Sequence: TACTGAAACCGGTTGCTGTT
Locus tag: Spro_4224
Name: bglE
Funciton: PTS system, beta-glucoside-specific IIB component (EC 2.7.1.69)
Locus tag: Spro_4223
Name: bglF
Funciton: PTS system, beta-glucoside-specific IIC component (EC 2.7.1.69)
Locus tag: Spro_4222
Name: bglG
Funciton: PTS system, beta-glucoside-specific IIA component (EC 2.7.1.69)
bglE
PTS system, beta-glucoside-specific IIB component (EC 2.7.1.69)
bglF
PTS system, beta-glucoside-specific IIC component (EC 2.7.1.69)
bglG
PTS system, beta-glucoside-specific IIA component (EC 2.7.1.69)

Position: -113
Score: 5.8
Sequence: TTGTGAAACCGGTTTCTTAT
Locus tag: Spro_0576
Name: ascF
Funciton: PTS system, arbutin-, cellobiose-, and salicin-specific IIBC component (EC 2.7.1.69)
Locus tag: Spro_0575
Name: ascB
Funciton: 6-phospho-beta-glucosidase ascB (EC 3.2.1.86)
ascF
PTS system, arbutin-, cellobiose-, and salicin-specific IIBC component (EC 2.7.1.69)
ascB
6-phospho-beta-glucosidase ascB (EC 3.2.1.86)

Position: -193
Score: 6.5
Sequence: ATAAGAAACCGGTTTCACAA
Locus tag: Spro_0577
Name: ascG
Funciton: Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
ascG
Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD