Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AscG in Erwinia amylovora ATCC 49946

Properties
Regulator type: Transcription factor
TF locus tag: EAM_2929
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization; Cellobiose utilization
Effector: Cellobiose-6-phosphate; Beta-glucoside-6-phosphate
Regulog: AscG - Enterobacteriales
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 28 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -297
Score: 6.1
Sequence: TTCTGCAACCGGTTTCATAT
Locus tag: EAM_2929
Name: ascG
Funciton: Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
ascG
Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family

Position: -68
Score: 6.6
Sequence: ATATGAAACCGGTTGCAGAA
Locus tag: EAM_2930
Name: bglE
Funciton: PTS system, beta-glucoside-specific IIB component (EC 2.7.1.69)
Locus tag: EAM_2931
Name: bglF
Funciton: PTS system, beta-glucoside-specific IIC component (EC 2.7.1.69)
Locus tag: EAM_2932
Name: bglG
Funciton: PTS system, beta-glucoside-specific IIA component (EC 2.7.1.69)
Locus tag: EAM_2933
Name: bglA
Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86)
Locus tag: EAM_2934
Name: bglA
Funciton: 6-phospho-beta-glucosidase (EC 3.2.1.86)
bglE
PTS system, beta-glucoside-specific IIB component (EC 2.7.1.69)
bglF
PTS system, beta-glucoside-specific IIC component (EC 2.7.1.69)
bglG
PTS system, beta-glucoside-specific IIA component (EC 2.7.1.69)
bglA
6-phospho-beta-glucosidase (EC 3.2.1.86)
bglA
6-phospho-beta-glucosidase (EC 3.2.1.86)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD