Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AscG in Enterobacter sp. 638

Properties
Regulator type: Transcription factor
TF locus tag: Ent638_3187
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization; Cellobiose utilization
Effector: Cellobiose-6-phosphate; Beta-glucoside-6-phosphate
Regulog: AscG - Enterobacteriales
Statistics of regulated genes:
- Genes 11
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 28 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -215
Score: 5.5
Sequence: CACGGAAACCGGTTACAGTA
Position: -202
Score: 5
Sequence: TACAGTAACCGGTTGCAGAG
Locus tag: Ent638_0526
Name: bglF
Funciton: PTS system, beta-glucoside-specific IIC component (EC 2.7.1.69)
bglF
PTS system, beta-glucoside-specific IIC component (EC 2.7.1.69)

Position: -72
Score: 4.7
Sequence: AATGGAAACCGGTTTCCATA
Locus tag: Ent638_0038
Name: celA
Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Locus tag: Ent638_0037
Name: celB
Funciton: PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
Locus tag: Ent638_0036
Name: bglB
Funciton: Beta-glucosidase (EC 3.2.1.21)
Locus tag: Ent638_0035
Name: celC
Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
Locus tag: Ent638_0034
Name: bglP
Funciton: putative outer membrane porin for beta-glucoside utilization
celA
PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
celB
PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
bglB
Beta-glucosidase (EC 3.2.1.21)
celC
PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
bglP
putative outer membrane porin for beta-glucoside utilization

Position: -126
Score: 5.4
Sequence: AATTGAAACCGGTTTCATAG
Locus tag: Ent638_0200
Name: celA2
Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Locus tag: Ent638_0199
Name: celC2
Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
celA2
PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
celC2
PTS system, cellobiose-specific IIA component (EC 2.7.1.69)

Position: -182
Score: 6.7
Sequence: ATAGGAAACCGGTTTCACAA
Locus tag: Ent638_3187
Name: ascG
Funciton: Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
ascG
Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family

Position: -52
Score: 5.6
Sequence: TTGTGAAACCGGTTTCCTAT
Locus tag: Ent638_3188
Name: ascF
Funciton: PTS system, arbutin-, cellobiose-, and salicin-specific IIBC component (EC 2.7.1.69)
Locus tag: Ent638_3189
Name: ascB
Funciton: 6-phospho-beta-glucosidase ascB (EC 3.2.1.86)
ascF
PTS system, arbutin-, cellobiose-, and salicin-specific IIBC component (EC 2.7.1.69)
ascB
6-phospho-beta-glucosidase ascB (EC 3.2.1.86)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD