Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of AscG in Citrobacter koseri ATCC BAA-895

Properties
Regulator type: Transcription factor
TF locus tag: CKO_04069
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization; Cellobiose utilization
Effector: Cellobiose-6-phosphate; Beta-glucoside-6-phosphate
Regulog: AscG - Enterobacteriales
Statistics of regulated genes:
- Genes 5
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 28 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -117
Score: 5.6
Sequence: TACTGCAACCGGTTTCAGTT
Locus tag: CKO_02999
Name: celA2
Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
Locus tag: CKO_03000
Name: celC2
Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
celA2
PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
celC2
PTS system, cellobiose-specific IIA component (EC 2.7.1.69)

Position: -172
Score: 6.7
Sequence: ATAGGAAACCGGTTCCACAA
Locus tag: CKO_04069
Name: ascG
Funciton: Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family
ascG
Transcriptional repressor of arbutine, salicine, cellibiose utilization, LacI family

Position: -103
Score: 5.1
Sequence: TTGTGGAACCGGTTTCCTAT
Locus tag: CKO_04070
Name: ascF
Funciton: PTS system, arbutin-, cellobiose-, and salicin-specific IIBC component (EC 2.7.1.69)
Locus tag: CKO_04071
Name: ascB
Funciton: 6-phospho-beta-glucosidase ascB (EC 3.2.1.86)
ascF
PTS system, arbutin-, cellobiose-, and salicin-specific IIBC component (EC 2.7.1.69)
ascB
6-phospho-beta-glucosidase ascB (EC 3.2.1.86)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD