Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of TyrR in Photorhabdus luminescens subsp. laumondii TTO1

Properties
Regulator type: Transcription factor
TF locus tag: plu2580
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Regulog: TyrR - Enterobacteriales
Statistics of regulated genes:
- Genes 5
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 106 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -178
Score: 3.7
Sequence: TTTTATAATCAATCTTACAA
Locus tag: plu2580
Name: tyrR
Funciton: Transcriptional regulator of aromatic amino acid biosynthesis
tyrR
Transcriptional regulator of aromatic amino acid biosynthesis

Position: -140
Score: 5.5
Sequence: TTGTAAACAATAATTTACAG
Position: -98
Score: 4.3
Sequence: TTGGATTGTATTCTTTACGA
Locus tag: plu1262
Name: aroF
Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
Locus tag: plu1263
Name: tyrA
Funciton: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
aroF
2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
tyrA
Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)

Position: -110
Score: 5.7
Sequence: TTGTAATTATTTATTTACAC
Locus tag: plu3066
Name: tyrP
Funciton: Tyrosine-specific transport protein
tyrP
Tyrosine-specific transport protein

Position: -69
Score: 4.1
Sequence: ATGTAAATTTCTGGTTACTA
Locus tag: plu1245
Name: aroL
Funciton: Shikimate kinase III (EC 2.7.1.71)
aroL
Shikimate kinase III (EC 2.7.1.71)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD