Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of TyrR in Escherichia coli str. K-12 substr. MG1655

Properties
Regulator type: Transcription factor
TF locus tag: b1323
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Regulog: TyrR - Enterobacteriales
Statistics of regulated genes:
- Genes 11
- Operons 8
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 106 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -89
Score: 3.7
Sequence: GTGTCAATGATTGTTGACAG
Locus tag: b1323
Name: tyrR
Funciton: Transcriptional regulator of aromatic amino acid biosynthesis
tyrR
Transcriptional regulator of aromatic amino acid biosynthesis

Position: -129
Score: 5.3
Sequence: CTGTAAAATAATATATACAG
Locus tag: b3161
Name: mtr
Funciton: Tryptophan-specific transport protein
mtr
Tryptophan-specific transport protein

Position: -182
Score: 4.5
Sequence: ACGTAAATCACACTTTACAG
Locus tag: b0048
Name: folA
Funciton: Dihydrofolate reductase (EC 1.5.1.3)
folA
Dihydrofolate reductase (EC 1.5.1.3)

Position: -75
Score: 5
Sequence: CCGTAAATTTTTATTGACAG
Locus tag: b0929
Name: ompF
Funciton: outer membrane porin F
ompF
outer membrane porin F

Position: -110
Score: 5.6
Sequence: TTGTACATTTATATTTACAC
Locus tag: b1907
Name: tyrP
Funciton: Tyrosine-specific transport protein
tyrP
Tyrosine-specific transport protein

Position: -165
Score: 5.4
Sequence: GTGTAAATTTATCTATACAG
Position: -113
Score: 5.4
Sequence: GTGTAAATAAAAATGTACGA
Position: -90
Score: 4
Sequence: ATGGATTGAAAACTTTACTT
Locus tag: b2601
Name: aroF
Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
Locus tag: b2600
Name: tyrA
Funciton: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
aroF
2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
tyrA
Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)

Position: -89
Score: 5
Sequence: ATGTAAACAAATTAATACAA
Locus tag: b0112
Name: aroP
Funciton: Aromatic amino acid transport protein AroP
aroP
Aromatic amino acid transport protein AroP

Position: -182
Score: 5.6
Sequence: ATGTAATTTATTATTTACAC
Position: -106
Score: 5
Sequence: GTGGAATTTTTTCTTTACAA
Locus tag: b0388
Name: aroL
Funciton: Shikimate kinase III (EC 2.7.1.71)
Locus tag: b0389
Name: yaiA
Funciton: hypothetical protein
Locus tag: b0390
Name: aroM
Funciton: AroM family protein
aroL
Shikimate kinase III (EC 2.7.1.71)
yaiA
hypothetical protein
aroM
AroM family protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD