Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of TyrR in Erwinia carotovora subsp. atroseptica SCRI1043

Properties
Regulator type: Transcription factor
TF locus tag: ECA1989
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Regulog: TyrR - Enterobacteriales
Statistics of regulated genes:
- Genes 5
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 106 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -90
Score: 4
Sequence: GTGTATAAAAATTTTGCCGA
Position: -68
Score: 5
Sequence: TAGTAATTTATACTTTACAC
Locus tag: ECA3884
Name: COG2814
Funciton: Predicted tyrosine transporter, COG2814 family
COG2814
Predicted tyrosine transporter, COG2814 family

Position: -156
Score: 5.2
Sequence: TGGTAATTTTTTATTTACAC
Position: -133
Score: 4.6
Sequence: GTGGATTTAAATCTTTACGG
Locus tag: ECA3352
Name: aroF
Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
Locus tag: ECA3351
Name: tyrA
Funciton: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
aroF
2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
tyrA
Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)

Position: -235
Score: 5.8
Sequence: GTGTAAATATAAAATTACAC
Locus tag: ECA1218
Name: tyrP
Funciton: Tyrosine-specific transport protein
tyrP
Tyrosine-specific transport protein

Position: -93
Score: 5.4
Sequence: CCGTAAAAATAAAATTACAC
Locus tag: ECA3791
Name: aroP
Funciton: Aromatic amino acid transport protein AroP
aroP
Aromatic amino acid transport protein AroP
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD