Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TunR - Desulfovibrionales

Properties
Regulator type: Transcription factor
Regulator family: TunR
Regulation mode: activator
Biological process: Tungsten homeostasis; Molybdenum homeostasis
Effector: Molybdate; Tungsten
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 37 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Desulfovibrio vulgaris Hildenborough 4 3
Desulfovibrio vulgaris str. Miyazaki F 17 9
Desulfovibrio desulfuricans G20 7 3
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 7 4
Desulfovibrio piger ATCC 29098 1 1
Desulfovibrio salexigens DSM 2638 6 1
Desulfovibrio magneticus RS-1 16 7
Lawsonia intracellularis PHE/MN1-00
Desulfomicrobium baculatum DSM 4028 4 3
Desulfohalobium retbaense DSM 5692
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
tupB
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0745: ABC-type tungstate transport system, periplasmic binding protein
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -117
score = 4.58609
sequence = TGTGCACGTTTTCTGCTTGTTTCGTGACTG

Gene: DvMF_2780: ABC-type tungstate transport system, periplasmic binding protein
 
Desulfovibrio desulfuricans G20

Gene: Dde_0234: ABC-type tungstate transport system, periplasmic binding protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1778: ABC-type tungstate transport system, periplasmic binding protein
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_01703: ABC-type tungstate transport system, periplasmic binding protein
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2876: ABC-type tungstate transport system, periplasmic binding protein
 
Desulfovibrio magneticus RS-1

Gene: DMR_12510: ABC-type tungstate transport system, periplasmic binding protein
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_3402: ABC-type tungstate transport system, periplasmic binding protein
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_2398: ABC-type tungstate transport system, periplasmic binding protein
ABC-type tungstate transport system, periplasmic binding protein
tupA
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0746: ABC-type tungstate transport system, permease protein
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2781: ABC-type tungstate transport system, permease protein
 
Desulfovibrio desulfuricans G20

Gene: Dde_0233: ABC-type tungstate transport system, permease protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1777: ABC-type tungstate transport system, permease protein
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_01702: ABC-type tungstate transport system, permease protein
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2875: ABC-type tungstate transport system, permease protein
 
Desulfovibrio magneticus RS-1

Gene: DMR_12520: ABC-type tungstate transport system, permease protein
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_3403: ABC-type tungstate transport system, permease protein
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_2397: ABC-type tungstate transport system, permease protein
ABC-type tungstate transport system, permease protein
tupC
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0747: ABC-type tungstate transport system, ATP-binding protein
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2782: ABC-type tungstate transport system, ATP-binding protein
 
Desulfovibrio desulfuricans G20

Gene: Dde_0232: ABC-type tungstate transport system, ATP-binding protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1776: ABC-type tungstate transport system, ATP-binding protein
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_01701: ABC-type tungstate transport system, ATP-binding protein
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2874: ABC-type tungstate transport system, ATP-binding protein
 
Desulfovibrio magneticus RS-1

Gene: DMR_12530: ABC-type tungstate transport system, ATP-binding protein
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_3404: ABC-type tungstate transport system, ATP-binding protein
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_2396: ABC-type tungstate transport system, ATP-binding protein
ABC-type tungstate transport system, ATP-binding protein
 
CRON 2.
modA
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -132
score = 6.3068
sequence = CGGTCACGTTCGTCACCATGAGGGTGACCG

Gene: DVU0177: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2474: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Desulfovibrio desulfuricans G20

Site:
position = -120
score = 6.68165
sequence = TTGTCACGATTTTCAGGACATTCGTGACCG

Gene: Dde_3518: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Site:
position = -100
score = 4.98381
sequence = TGTTCACGCTTTTTATGTAAATCGTGATCT

Gene: Ddes_0168: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Desulfovibrio piger ATCC 29098

Site:
position = -99
score = 5.01602
sequence = TTGTCGCGCTTTTCGTATAATCCGTGCCTG

Gene: DESPIG_00488: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
*
Desulfovibrio salexigens DSM 2638

Site:
position = -119
score = 6.46537
sequence = CAGTCACGTTTTTATTAGAATGCGTGACCG

Gene: Desal_0306: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Desulfovibrio magneticus RS-1

Gene: DMR_17460: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Lawsonia intracellularis PHE/MN1-00
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -90
score = 6.07239
sequence = CAGTCACGCTTTATCATGCGTGCGTGACCA

Gene: Dbac_1581: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
 
Desulfohalobium retbaense DSM 5692
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
modB
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -219
score = 5.41904
sequence = CGGTCACCACCCGGCAACATTCCGTGACCA

Gene: DVU0181: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -67
score = 5.35854
sequence = CGGTCACCAAGACGAAAGTTTTCGTGCCTC

Gene: DvMF_2478: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Desulfovibrio desulfuricans G20

Gene: Dde_3519: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0169: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_00491: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0305: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
*
Desulfovibrio magneticus RS-1

Site:
position = -144
score = 4.49151
sequence = GAGACACCCATATTCTATTTGCCGTGACAT

Site:
position = -224
score = 4.19229
sequence = CTGACACGGCAATATAAAAACAAGTGACTC

Gene: DMR_17470: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Lawsonia intracellularis PHE/MN1-00
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -179
score = 6.62502
sequence = CGGTCACGCTTTTCCGCGCTACCGTGACCG

Gene: Dbac_1578: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
 
Desulfohalobium retbaense DSM 5692
Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
modC
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0180: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2477: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Desulfovibrio desulfuricans G20

Gene: Dde_3520: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0170: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_00492: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0304: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 2
Desulfovibrio magneticus RS-1

Gene: DMR_17450: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)

Gene: DMR_19520: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_1579: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
 
Desulfohalobium retbaense DSM 5692
Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
modA
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
*
Desulfovibrio desulfuricans G20

Site:
position = -134
score = 6.53314
sequence = CTGTCACGCATTTTATTTTTTTCGTGACCG

Gene: Dde_0155: ABC-type molybdate transport system, periplasmic component
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0303: ABC-type molybdate transport system, periplasmic component
 
Desulfovibrio magneticus RS-1

Gene: DMR_19530: ABC-type molybdate transport system, periplasmic component
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
ABC-type molybdate transport system, periplasmic component
modB
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20

Gene: Dde_0154: ABC-type molybdate transport system, permease component
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0302: ABC-type molybdate transport system, permease component
 
Desulfovibrio magneticus RS-1

Gene: DMR_19540: ABC-type molybdate transport system, permease component
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
ABC-type molybdate transport system, permease component
Dde_0153
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20

Gene: Dde_0153: hypothetical protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_00663: hypothetical protein
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_0301: hypothetical protein
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1818: hypothetical protein
hypothetical protein
DMR_19510
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
*
Desulfovibrio magneticus RS-1

Site:
position = -213
score = 4.33689
sequence = ATATCACGAATAATACCCTGTACGTGTCAG

Site:
position = -160
score = 3.75668
sequence = CTGTCACTTGTTTTGTATTTGCCGTGTCGT

Gene: DMR_19510: putative esterase
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
putative esterase
DvMF_2475
 
Desulfovibrio vulgaris Hildenborough
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -235
score = 5.68298
sequence = CAGTCACGAAAAAAACAGCCCAGGTGACCG

Gene: DvMF_2475: COG1720: Uncharacterized conserved protein
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
COG1720: Uncharacterized conserved protein
 
CRON 3.
DvMF_1598
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
*
Desulfovibrio magneticus RS-1

Site:
position = -213
score = 4.99874
sequence = CTCTCACGCACTAGCAGGAAATCGTGATTG

Gene: DMR_08230: iron-sulfur binding protein
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
NADH-ubiquinone oxidoreductase chain I (EC 1.6.5.3)
phsB
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0172: iron-sulfur cluster-binding protein
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_0319: 4Fe-4S ferredoxin, iron-sulfur binding domain protein
 
Desulfovibrio desulfuricans G20

Gene: Dde_1075: Fe-S-cluster-containing hydrogenase components 1
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1666: Anaerobic dimethyl sulfoxide reductase chain B (EC 1.8.99.-)
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_00535: hypothetical protein
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1

Gene: DMR_08240: iron-sulfur binding protein
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI1064: 4Fe-4S ferredoxin, iron-sulfur binding domain protein
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_2859: 4Fe-4S ferredoxin iron-sulfur binding domain protein
 
Desulfohalobium retbaense DSM 5692
thiosulfate reductase (phsB)
phsA
 
Desulfovibrio vulgaris Hildenborough

Gene: null: thiosulfate reductase
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -335
score = 5.59137
sequence = CGGGCACGATATGTCCTGCTTTCGTGCCTG

Site:
position = -138
score = 4.6302
sequence = TGGTCACGCGTGTATCGGAATGCGTGTTCC

Gene: DvMF_0320: molybdopterin oxidoreductase
 
Desulfovibrio desulfuricans G20

Gene: Dde_1076: COG0243: Anaerobic dehydrogenases, typically selenocysteine-containing
*
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Site:
position = -399
score = 4.33091
sequence = TGTTCACGAAAATGAAAAATAGCGTGTAAA

Gene: Ddes_1667: molybdopterin oxidoreductase
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_00534: hypothetical protein
 
Desulfovibrio salexigens DSM 2638
*
Desulfovibrio magneticus RS-1

Site:
position = -19
score = 4.99874
sequence = CAATCACGATTTCCTGCTAGTGCGTGAGAG

Gene: DMR_08220: putative thiosulfate reductase
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_2860: molybdopterin oxidoreductase
 
Desulfohalobium retbaense DSM 5692
thiosulfate reductase
 
CRON 4.
fdhE
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0577: formate dehydrogenase formation protein FdhE
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -83
score = 5.99569
sequence = CAGGCACGGCCTGCCGGAAAATCGTGACCG

Gene: DvMF_1233: formate dehydrogenase formation protein FdhE
 
Desulfovibrio desulfuricans G20

Gene: Dde_0706: formate dehydrogenase formation protein FdhE
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2878: formate dehydrogenase formation protein FdhE
 
Desulfovibrio magneticus RS-1

Gene: DMR_24510: formate dehydrogenase formation protein FdhE
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0982: formate dehydrogenase formation protein FdhE
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0279: formate dehydrogenase formation protein FdhE
formate dehydrogenase formation protein FdhE
fdhD
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0578: Formate dehydrogenase chain D (EC 1.2.1.2)
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_1232: Formate dehydrogenase chain D (EC 1.2.1.2)
 
Desulfovibrio desulfuricans G20

Gene: Dde_0707: Formate dehydrogenase chain D (EC 1.2.1.2)
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2877: Formate dehydrogenase chain D (EC 1.2.1.2)
 
Desulfovibrio magneticus RS-1

Gene: DMR_24500: Formate dehydrogenase chain D (EC 1.2.1.2)
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_2410: Formate dehydrogenase chain D (EC 1.2.1.2)
Formate dehydrogenase chain D (EC 1.2.1.2)
mobA
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0579: molybdopterin-guanine dinucleotide biosynthesis protein A, putative
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_1231: molybdopterin-guanine dinucleotide biosynthesis protein A, putative
 
Desulfovibrio desulfuricans G20

Gene: Dde_0708: molybdopterin-guanine dinucleotide biosynthesis protein A, putative
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1

Gene: DMR_24490: molybdopterin-guanine dinucleotide biosynthesis protein A, putative
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0278: molybdopterin-guanine dinucleotide biosynthesis protein A, putative
molybdopterin-guanine dinucleotide biosynthesis protein A, putative
moaA
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0580: Molybdenum cofactor biosynthesis protein MoaA
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_1230: Molybdenum cofactor biosynthesis protein MoaA
 
Desulfovibrio desulfuricans G20

Gene: Dde_0709: Molybdenum cofactor biosynthesis protein MoaA
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1269: Molybdenum cofactor biosynthesis protein MoaA
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02699: Molybdenum cofactor biosynthesis protein MoaA
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_2879: Molybdenum cofactor biosynthesis protein MoaA
 
Desulfovibrio magneticus RS-1

Gene: DMR_24480: Molybdenum cofactor biosynthesis protein MoaA
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0240: Molybdenum cofactor biosynthesis protein MoaA
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1734: Molybdenum cofactor biosynthesis protein MoaA
Molybdenum cofactor biosynthesis protein MoaA
 
CRON 5.
modE
 2
Desulfovibrio vulgaris Hildenborough

Gene: DVU1759: Molybdate-responsive transcriptional regulator ModE

Gene: DVU1561: Molybdate-responsive transcriptional regulator ModE
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -96
score = 5.89872
sequence = CAGTCACGCGAACCATGCCGGACGTGACCC

Gene: DvMF_0650: Molybdate-responsive transcriptional regulator ModE
 2
Desulfovibrio desulfuricans G20

Gene: Dde_3511: Molybdate-responsive transcriptional regulator ModE

Gene: Dde_3521: Molybdate-responsive transcriptional regulator ModE
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 2
Desulfovibrio salexigens DSM 2638

Gene: Desal_2331: Molybdate-responsive transcriptional regulator ModE

Gene: Desal_2665: Molybdate-responsive transcriptional regulator ModE
 
Desulfovibrio magneticus RS-1

Gene: DMR_43980: Molybdate-responsive transcriptional regulator ModE
 
Lawsonia intracellularis PHE/MN1-00
 2
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0983: Molybdate-responsive transcriptional regulator ModE

Gene: Dbac_1565: Molybdate-responsive transcriptional regulator ModE
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_2172: Molybdate-responsive transcriptional regulator ModE
Molybdate-responsive transcriptional regulator ModE
 
CRON 6.
Ddes_0089
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0770: TSUP family transporter
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2812: TSUP family transporter
 
Desulfovibrio desulfuricans G20
*
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Site:
position = -100
score = 5.04123
sequence = TATTCACGATTATTATAAAAACCGTGAACA

Gene: Ddes_0089: TSUP family transporter
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_01961: TSUP family transporter
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1

Gene: DMR_43930: TSUP family transporter
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI0911: TSUP family transporter
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_2091: TSUP family transporter
 
Desulfohalobium retbaense DSM 5692
TSUP family transporter
 
CRON 7.
DVU0175
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0175: tungsten formylmethanofuran dehydrogenase family protein/molybdopterin binding protein
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -243
score = 5.58075
sequence = ATGTCACGCCAAGTCGCGCTTCCGTGACTG

Site:
position = -371
score = 4.47535
sequence = CCTACACGCTTTGCATCCAACCCGTGACCA

Gene: DvMF_1613: molybdopterin binding domain
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0554: molybdopterin binding domain
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
tungsten formylmethanofuran dehydrogenase family protein/molybdopterin binding protein
 
CRON 8.
DMR_27630
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
*
Desulfovibrio magneticus RS-1

Site:
position = -328
score = 5.16303
sequence = CTGTCATGTGAATAGAATTATTCGTGACAG

Gene: DMR_27630: putative TonB-dependent receptor
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
putative TonB-dependent receptor
DMR_27640
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1

Gene: DMR_27640: hypothetical membrane protein
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
hypothetical membrane protein
DMR_27650
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1

Gene: DMR_27650: putative ABC transporter ATP-binding protein
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
putative ABC transporter ATP-binding protein
DMR_27660
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1

Gene: DMR_27660: hypothetical membrane protein
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
hypothetical membrane protein
 
CRON 9.
DvMF_2403
 
Desulfovibrio vulgaris Hildenborough
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -145
score = 4.89583
sequence = CGGTCACGATAATTTTATTTTGCATGGCTC

Gene: DvMF_2403: Molybdate-binding domain of ModE
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
Molybdate-binding domain of ModE
 
CRON 10.
TunR
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -102
score = 6.3068
sequence = CGGTCACCCTCATGGTGACGAACGTGACCG

Gene: DVU0179: XerD family transcriptional regulator
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -108
score = 5.68298
sequence = CGGTCACCTGGGCTGTTTTTTTCGTGACTG

Gene: DvMF_2476: XerD family transcriptional regulator
*
Desulfovibrio desulfuricans G20

Site:
position = -51
score = 6.68165
sequence = CGGTCACGAATGTCCTGAAAATCGTGACAA

Gene: Dde_3517: XerD family transcriptional regulator
*
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Site:
position = -85
score = 4.98381
sequence = AGATCACGATTTACATAAAAAGCGTGAACA

Gene: Ddes_0167: XerD family transcriptional regulator
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
*2
Desulfovibrio magneticus RS-1

Site:
position = -103
score = 5.85392
sequence = TTGTCACGAGTTGCAAAACTTGCGTGACAA

Site:
position = -49
score = 4.7706
sequence = TTGTCACCTCATTTTTTCTTTTCGTGATAA

Gene: DMR_12820: XerD family transcriptional regulator

Site:
position = -342
score = 3.97328
sequence = GCGTCATGACTTTTCTACTTTGCGTGTCAT

Site:
position = -248
score = 4.33689
sequence = CTGACACGTACAGGGTATTATTCGTGATAT

Gene: DMR_19500: XerD family transcriptional regulator
 
Lawsonia intracellularis PHE/MN1-00
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -112
score = 6.07239
sequence = TGGTCACGCACGCATGATAAAGCGTGACTG

Gene: Dbac_1580: XerD family transcriptional regulator
 
Desulfohalobium retbaense DSM 5692
XerD family transcriptional regulator
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD