Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Desulfovibrionales

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Desulfovibrio vulgaris Hildenborough 2 1
Desulfovibrio vulgaris str. Miyazaki F 2 1
Desulfovibrio desulfuricans G20 2 1
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Desulfovibrio piger ATCC 29098
Desulfovibrio salexigens DSM 2638
Desulfovibrio magneticus RS-1 5 2
Lawsonia intracellularis PHE/MN1-00
Desulfomicrobium baculatum DSM 4028 2 1
Desulfohalobium retbaense DSM 5692 2 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hrcA
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0813: Heat shock response transcriptional regulator HrcA, HrcA family
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_1195: Heat shock response transcriptional regulator HrcA, HrcA family
 
Desulfovibrio desulfuricans G20

Gene: Dde_1026: Heat shock response transcriptional regulator HrcA, HrcA family
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
*
Desulfovibrio magneticus RS-1

Site:
position = -40
score = 5.80609
sequence = TTGGCACTCGAAAGCCACGAGTGCCAA

Gene: DMR_17390: Heat shock response transcriptional regulator HrcA, HrcA family
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_2882: Heat shock response transcriptional regulator HrcA, HrcA family
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0305: Heat shock response transcriptional regulator HrcA, HrcA family
Heat shock response transcriptional regulator HrcA, HrcA family
grpE
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0812: Heat shock protein GrpE
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_1194: Heat shock protein GrpE
 
Desulfovibrio desulfuricans G20

Gene: Dde_1025: Heat shock protein GrpE
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1053: Heat shock protein GrpE
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_00447: Heat shock protein GrpE
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_1567: Heat shock protein GrpE
 
Desulfovibrio magneticus RS-1

Gene: DMR_17380: Heat shock protein GrpE
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI1048: Heat shock protein GrpE
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_2881: Heat shock protein GrpE
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0304: Heat shock protein GrpE
Heat shock protein GrpE
dnaK
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0811: Chaperone protein DnaK
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2835: Chaperone protein DnaK
 
Desulfovibrio desulfuricans G20

Gene: Dde_1023: Chaperone protein DnaK
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_2151: Chaperone protein DnaK
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02364: Chaperone protein DnaK
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_1566: Chaperone protein DnaK
 
Desulfovibrio magneticus RS-1

Gene: DMR_17370: Chaperone protein DnaK
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI0912: Chaperone protein DnaK
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_2893: Chaperone protein DnaK
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_0303: Chaperone protein DnaK
Chaperone protein DnaK
 
CRON 2.
groS
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -69
score = 6.58148
sequence = CTGGCACTCATCACAAGAGAGTGCCAA

Gene: DVU1977: Heat shock protein 60 family co-chaperone GroES
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -72
score = 6.09047
sequence = TTGGCACTCGCACCCCGCGAGTGCCAA

Gene: DvMF_3063: Heat shock protein 60 family co-chaperone GroES
*
Desulfovibrio desulfuricans G20

Site:
position = -69
score = 7.17366
sequence = TTGGCACTCGCGTGAAGAGAGTGCTAA

Gene: Dde_2474: Heat shock protein 60 family co-chaperone GroES
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1547: Heat shock protein 60 family co-chaperone GroES
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_00652: Heat shock protein 60 family co-chaperone GroES
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_3023: Heat shock protein 60 family co-chaperone GroES
*
Desulfovibrio magneticus RS-1

Site:
position = -65
score = 5.8817
sequence = CTGGCACTCGCCGCAAGCGAGTGCCAG

Gene: DMR_02720: Heat shock protein 60 family co-chaperone GroES
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI0624: Heat shock protein 60 family co-chaperone GroES
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -76
score = 5.87827
sequence = TTGGCACTCCCCATTGCCGAGCGCCAA

Gene: Dbac_2625: Heat shock protein 60 family co-chaperone GroES
*
Desulfohalobium retbaense DSM 5692

Site:
position = -69
score = 6.81158
sequence = TTAGCACTCCCCTGACAGGAGTGCTAA

Gene: Dret_2175: Heat shock protein 60 family co-chaperone GroES
Heat shock protein 60 family co-chaperone GroES
groL
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU1976: Heat shock protein 60 family chaperone GroEL
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_3064: Heat shock protein 60 family chaperone GroEL
 
Desulfovibrio desulfuricans G20

Gene: Dde_2473: Heat shock protein 60 family chaperone GroEL
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1548: Heat shock protein 60 family chaperone GroEL
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_00651: Heat shock protein 60 family chaperone GroEL
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_3024: Heat shock protein 60 family chaperone GroEL
 
Desulfovibrio magneticus RS-1

Gene: DMR_02710: Heat shock protein 60 family chaperone GroEL
 
Lawsonia intracellularis PHE/MN1-00

Gene: LI0625: Heat shock protein 60 family chaperone GroEL
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_2624: Heat shock protein 60 family chaperone GroEL
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_2176: Heat shock protein 60 family chaperone GroEL
Heat shock protein 60 family chaperone GroEL
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD