Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog DVU2423 - Desulfovibrionales

Properties
Regulator type: Transcription factor
Regulator family: HxlR
Regulation mode:
Biological process: Nitrogen metabolism
Effector:
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Desulfovibrio vulgaris Hildenborough 4 2
Desulfovibrio vulgaris str. Miyazaki F 6 2
Desulfovibrio desulfuricans G20
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Desulfovibrio piger ATCC 29098
Desulfovibrio salexigens DSM 2638
Desulfovibrio magneticus RS-1 5 2
Lawsonia intracellularis PHE/MN1-00
Desulfomicrobium baculatum DSM 4028 4 2
Desulfohalobium retbaense DSM 5692 1 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
DVU2423
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -19
score = 5.32668
sequence = TTGTACCCTAGAGGATACCA

Gene: DVU2423: Transcriptional regulator, HxlR family
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -73
score = 4.9535
sequence = TAGTATCCTGCGGCATACCA

Gene: DvMF_2974: Transcriptional regulator, HxlR family
 
Desulfovibrio desulfuricans G20

Gene: Dde_1352: Transcriptional regulator, HxlR family
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
*
Desulfovibrio magneticus RS-1

Site:
position = -37
score = 5.02958
sequence = TAGTATCCTTTTGGATACCA

Gene: DMR_35240: Transcriptional regulator, HxlR family
 
Lawsonia intracellularis PHE/MN1-00
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -35
score = 4.44409
sequence = GTCTATAATGTACGGTACAC

Gene: Dbac_0456: Transcriptional regulator, HxlR family
*
Desulfohalobium retbaense DSM 5692

Site:
position = -143
score = 4.09026
sequence = GTGTGCCCTGCTTTGCATAC

Gene: Dret_0703: Transcriptional regulator, HxlR family
Transcriptional regulator, HxlR family
 
CRON 2.
DVU2422
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -102
score = 5.32668
sequence = TGGTATCCTCTAGGGTACAA

Gene: DVU2422: Nitroreductase family protein
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -235
score = 4.9535
sequence = TGGTATGCCGCAGGATACTA

Gene: DvMF_2975: Nitroreductase family protein
 
Desulfovibrio desulfuricans G20

Gene: Dde_1353: Nitroreductase family protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_1158: Nitroreductase family protein
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_01040: Nitroreductase family protein
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_3763: Nitroreductase family protein
*
Desulfovibrio magneticus RS-1

Site:
position = -106
score = 5.02958
sequence = TGGTATCCAAAAGGATACTA

Gene: DMR_35230: Nitroreductase family protein
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0082: Nitroreductase family protein
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1204: Nitroreductase family protein
Nitroreductase family protein
dmpI
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU2421: 4-oxalocrotonate tautomerase (EC 5.3.2.-)
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2976: 4-oxalocrotonate tautomerase (EC 5.3.2.-)
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
4-oxalocrotonate tautomerase (EC 5.3.2.-)
DvMF_2977
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2977: NADH:flavin oxidoreductase/NADH oxidase
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1

Gene: DMR_34800: NADH:flavin oxidoreductase/NADH oxidase
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
NADH:flavin oxidoreductase/NADH oxidase
DVU2420
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU2420: conserved hypothetical protein
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2978: conserved hypothetical protein
 
Desulfovibrio desulfuricans G20

Gene: Dde_1354: conserved hypothetical protein
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
conserved hypothetical protein
DvMF_2979
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2979: NADPH-dependent FMN reductase
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1

Gene: DMR_35200: NADPH-dependent FMN reductase
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
NADPH-dependent FMN reductase
flr
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0384: Flavoredoxin
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_1572: Flavoredoxin
 
Desulfovibrio desulfuricans G20

Gene: Dde_0187: Flavoredoxin
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02858: Flavoredoxin
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_1844: Flavoredoxin
 
Desulfovibrio magneticus RS-1

Gene: DMR_35220: Flavoredoxin
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_3486: Flavoredoxin
 
Desulfohalobium retbaense DSM 5692
Flavoredoxin
DMR_35210
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1

Gene: DMR_35210: putative flavoredoxin
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
putative flavoredoxin
 
CRON 3.
Dbac_0455
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -98
score = 4.44409
sequence = GTGTACCGTACATTATAGAC

Gene: Dbac_0455: NADPH-dependent FMN reductase
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1264: NADPH-dependent FMN reductase
NADPH-dependent FMN reductase
Dbac_0454
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0454: nitroreductase
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_2365: nitroreductase
nitroreductase
Dbac_0453
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_0453: protein of unknown function DUF6 transmembrane
 
Desulfohalobium retbaense DSM 5692
protein of unknown function DUF6 transmembrane
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD