Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog DVU0030 - Desulfovibrionales

Properties
Regulator type: Transcription factor
Regulator family: GntR/MocR
Regulation mode:
Biological process: Amino acid transport
Effector:
Phylum: Proteobacteria/delta
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 17 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Desulfovibrio vulgaris Hildenborough 3 2
Desulfovibrio vulgaris str. Miyazaki F 3 2
Desulfovibrio desulfuricans G20 3 2
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Desulfovibrio piger ATCC 29098
Desulfovibrio salexigens DSM 2638 4 2
Desulfovibrio magneticus RS-1 1 1
Lawsonia intracellularis PHE/MN1-00
Desulfomicrobium baculatum DSM 4028 4 2
Desulfohalobium retbaense DSM 5692 3 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
DVU0031
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -431
score = 5.15382
sequence = TAAAAACTGTATCTGTCATCA

Gene: DVU0031: Branched-chain amino acid transport protein azlC
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -124
score = 4.4142
sequence = GTTTGACTGTATCTGTTCAGG

Gene: DvMF_2174: Branched-chain amino acid transport protein azlC
*
Desulfovibrio desulfuricans G20

Site:
position = -109
score = 4.61573
sequence = TGAAAATTGTATCTGTGTTTG

Site:
position = -127
score = 5.56084
sequence = TAAAAACTGTATCTGTTCTGA

Gene: Dde_0158: Branched-chain amino acid transport protein azlC
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0523: Branched-chain amino acid transport protein azlC
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02860: Branched-chain amino acid transport protein azlC
*
Desulfovibrio salexigens DSM 2638

Site:
position = -93
score = 4.85103
sequence = TAAAATCTGTATCTGTACTGA

Site:
position = -118
score = 4.89434
sequence = CTAAAACTGTTACGGTTCATA

Gene: Desal_3216: Branched-chain amino acid transport protein azlC
 
Desulfovibrio magneticus RS-1

Gene: DMR_42190: Branched-chain amino acid transport protein azlC
 
Lawsonia intracellularis PHE/MN1-00
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -64
score = 4.35463
sequence = CGCAAACTGTATCTGTACCGC

Gene: Dbac_3053: Branched-chain amino acid transport protein azlC
*
Desulfohalobium retbaense DSM 5692

Site:
position = -372
score = 4.47259
sequence = TCGAAATTGTATCTGTCTCAG

Gene: Dret_1470: Branched-chain amino acid transport protein azlC
Branched-chain amino acid transport protein azlC
DVU0032
 
Desulfovibrio vulgaris Hildenborough

Gene: DVU0032: Branched-chain amino acid transport protein azlD
 
Desulfovibrio vulgaris str. Miyazaki F

Gene: DvMF_2173: Branched-chain amino acid transport protein azlD
 
Desulfovibrio desulfuricans G20

Gene: Dde_0159: Branched-chain amino acid transport protein azlD
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Gene: Ddes_0522: Branched-chain amino acid transport protein azlD
 
Desulfovibrio piger ATCC 29098

Gene: DESPIG_02861: Branched-chain amino acid transport protein azlD
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_3217: Branched-chain amino acid transport protein azlD
 
Desulfovibrio magneticus RS-1

Gene: DMR_42200: Branched-chain amino acid transport protein azlD
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_3054: Branched-chain amino acid transport protein azlD
 
Desulfohalobium retbaense DSM 5692

Gene: Dret_1469: Branched-chain amino acid transport protein azlD
Branched-chain amino acid transport protein azlD
Dbac_3055
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028

Gene: Dbac_3055: putative aminotransferase
 
Desulfohalobium retbaense DSM 5692
putative aminotransferase
Desal_3218
 
Desulfovibrio vulgaris Hildenborough
 
Desulfovibrio vulgaris str. Miyazaki F
 
Desulfovibrio desulfuricans G20
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
 
Desulfovibrio salexigens DSM 2638

Gene: Desal_3218: metal dependent phosphohydrolase
 
Desulfovibrio magneticus RS-1
 
Lawsonia intracellularis PHE/MN1-00
 
Desulfomicrobium baculatum DSM 4028
 
Desulfohalobium retbaense DSM 5692
metal dependent phosphohydrolase
 
CRON 2.
DVU0030
*
Desulfovibrio vulgaris Hildenborough

Site:
position = -40
score = 5.15382
sequence = TGATGACAGATACAGTTTTTA

Gene: DVU0030: transcriptional regulator, GntR family
*
Desulfovibrio vulgaris str. Miyazaki F

Site:
position = -196
score = 4.4142
sequence = CCTGAACAGATACAGTCAAAC

Gene: DvMF_2175: transcriptional regulator, GntR family
*
Desulfovibrio desulfuricans G20

Site:
position = -44
score = 5.56084
sequence = TCAGAACAGATACAGTTTTTA

Site:
position = -62
score = 4.61573
sequence = CAAACACAGATACAATTTTCA

Gene: Dde_0157: transcriptional regulator, GntR family
 
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
 
Desulfovibrio piger ATCC 29098
*
Desulfovibrio salexigens DSM 2638

Site:
position = -39
score = 4.89434
sequence = TATGAACCGTAACAGTTTTAG

Site:
position = -64
score = 4.85103
sequence = TCAGTACAGATACAGATTTTA

Gene: Desal_3215: transcriptional regulator, GntR family
*
Desulfovibrio magneticus RS-1

Site:
position = -71
score = 4.65342
sequence = CCATCACAGACACAGTTTTCA

Gene: DMR_35550: transcriptional regulator, GntR family
 
Lawsonia intracellularis PHE/MN1-00
*
Desulfomicrobium baculatum DSM 4028

Site:
position = -536
score = 4.35463
sequence = GCGGTACAGATACAGTTTGCG

Gene: Dbac_3052: transcriptional regulator, GntR family
*
Desulfohalobium retbaense DSM 5692

Site:
position = -40
score = 4.47259
sequence = CTGAGACAGATACAATTTCGA

Gene: Dret_1471: transcriptional regulator, GntR family
transcriptional regulator, GntR family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD