Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 67 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 10 6
Bacillus amyloliquefaciens FZB42 8 5
Bacillus pumilus SAFR-032 8 5
Bacillus licheniformis DSM 13 10 9
Anoxybacillus flavithermus WK1 5 3
Geobacillus kaustophilus HTA426 3 1
Bacillus cereus ATCC 14579 6 4
Bacillus halodurans C-125 9 4
Bacillus clausii KSM-K16 11 6
Oceanobacillus iheyensis HTE831 10 5
Paenibacillus sp. JDR-2 8 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rpmGA1
 
Bacillus subtilis subsp. subtilis str. 168
*
Bacillus amyloliquefaciens FZB42

Site:
position = -40
score = 6.81952
sequence = TAAAACGTAATAATTACGATTTG

Gene: RBAM_022140: 50S ribosomal protein L33
*
Bacillus pumilus SAFR-032

Site:
position = -42
score = 6.48021
sequence = CAAATCGTAACCATTACGAATTA

Gene: BPUM_3310: 50S ribosomal protein L33
*
Bacillus licheniformis DSM 13

Site:
position = -37
score = 6.62875
sequence = TAAAGCGTAATGATTACGTTTTA

Gene: BLi02553: 50S ribosomal protein L33
*
Anoxybacillus flavithermus WK1

Site:
position = -45
score = 6.26446
sequence = CAAAACGTAATGATTACTATTTT

Gene: Aflv_1438: 50S ribosomal protein L33
 
Geobacillus kaustophilus HTA426
*
Bacillus cereus ATCC 14579

Site:
position = -55
score = 7.00692
sequence = TAAATCGTAATCATTACGTTTTA

Gene: BC4339: 50S ribosomal protein L33
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC1721: 50S ribosomal protein L33
 
Oceanobacillus iheyensis HTE831

Gene: OB1925: 50S ribosomal protein L33
 
Paenibacillus sp. JDR-2
50S ribosomal protein L33
 
CRON 2.
rpmE2
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -39
score = 6.9526
sequence = TAAAACGTAATTATTACGATTTA

Gene: BSU30700: 50S ribosomal protein L31 type B
*
Bacillus amyloliquefaciens FZB42

Site:
position = -39
score = 6.81952
sequence = TAAAACGTAATTATTACGATTTG

Gene: RBAM_027710: 50S ribosomal protein L31 type B
*
Bacillus pumilus SAFR-032

Site:
position = -44
score = 6.49567
sequence = TAAAGCGTAATGATTACGTTTTG

Gene: BPUM_2709: 50S ribosomal protein L31 type B
*
Bacillus licheniformis DSM 13

Site:
position = -39
score = 6.59942
sequence = TAAAACGTAATTATTACGTTTTG

Gene: BLi03214: 50S ribosomal protein L31 type B
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC5331: 50S ribosomal protein L31 type B
 
Bacillus halodurans C-125

Gene: BH3780: 50S ribosomal protein L31 type B
 
Bacillus clausii KSM-K16

Gene: ABC3878: 50S ribosomal protein L31 type B
 
Oceanobacillus iheyensis HTE831

Gene: OB3000: 50S ribosomal protein L31 type B
 
Paenibacillus sp. JDR-2
50S ribosomal protein L31 type B
ytiB
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU30690: Carbonic anhydrase (EC 4.2.1.1)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_027700: Carbonic anhydrase (EC 4.2.1.1)
*
Bacillus pumilus SAFR-032

Site:
position = -151
score = 6.45862
sequence = TGTATCGTAATAATTACGATTTG

Site:
position = -188
score = 6.07393
sequence = TAGATAGAAATGATTACGATTTA

Gene: BPUM_2707: Carbonic anhydrase (EC 4.2.1.1)
*
Bacillus licheniformis DSM 13

Site:
position = -111
score = 6.22215
sequence = TAAAACGTAATTGTTTCGATTTG

Gene: BLi03211: Carbonic anhydrase (EC 4.2.1.1)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Carbonic anhydrase (EC 4.2.1.1)
 
CRON 3.
BH0366
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
*
Bacillus cereus ATCC 14579

Site:
position = -68
score = 6.66144
sequence = TAAATCGTAATTATTACGCTTTG

Gene: BC1926: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Bacillus halodurans C-125

Site:
position = -40
score = 6.59512
sequence = TAAATAGGAATTATTACGATTTA

Gene: BH0366: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
BH0367
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
*
Bacillus licheniformis DSM 13

Site:
position = -41
score = 5.89526
sequence = CAAATCGGAATAATTCTGTTTTA

Site:
position = -245
score = 6.68644
sequence = CAAATCGTAATAATTACGTTTTG

Gene: BLi01934: NADH-ubiquinone oxidoreductase 51 kDa subunit
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426

Gene: GK1810: NADH-ubiquinone oxidoreductase 51 kDa subunit
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH0367: NADH-ubiquinone oxidoreductase 51 kDa subunit
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
NADH-ubiquinone oxidoreductase 51 kDa subunit
BH0368
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH0368: Deoxycytidine triphosphate deaminase (EC 3.5.4.13)
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Deoxycytidine triphosphate deaminase (EC 3.5.4.13)
sufE2
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
*
Bacillus licheniformis DSM 13

Site:
position = -98
score = 6.81277
sequence = TAAATCGTAATTATTATGATTTA

Gene: BLi01970: Putative iron-sulfur cluster assembly scaffold protein for SUF system, SufE2
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH0369: Putative iron-sulfur cluster assembly scaffold protein for SUF system, SufE2
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Putative iron-sulfur cluster assembly scaffold protein for SUF system, SufE2
OB3434
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
*
Oceanobacillus iheyensis HTE831

Site:
position = -40
score = 6.87384
sequence = TAAATCGTAATGATTACGTTTTG

Gene: OB3434: Hypothetical protein
 
Paenibacillus sp. JDR-2
Hypothetical protein
BLi01933
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi01933: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC2019: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Bacillus halodurans C-125
*
Bacillus clausii KSM-K16

Site:
position = -85
score = 6.18929
sequence = TAAATCGTAATTGATACGATTTG

Gene: ABC1119: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Oceanobacillus iheyensis HTE831

Site:
position = -55
score = 5.04309
sequence = TTATTCGTAATGATTACGGATAT

Gene: OB3433: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Paenibacillus sp. JDR-2
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
CRON 4.
znuC
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
*
Paenibacillus sp. JDR-2

Site:
position = -67
score = 5.78657
sequence = CTAATCGTAATAGTTACGAAATA

Site:
position = -118
score = 5.17062
sequence = TTATACGTAATTATTACGTTCAA

Site:
position = -162
score = 5.59229
sequence = TTAATCGTAATGTTGACGATTAA

Gene: Pjdr2_3065: ABC-type Mn/Zn transport systems, ATPase component
ABC-type Mn/Zn transport systems, ATPase component
znuB
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_3066: ABC-type Mn2+/Zn2+ transport systems, permease component
ABC-type Mn2+/Zn2+ transport systems, permease component
znuC
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_3067: ABC-type Mn2+/Zn2+ transport systems, Zn2+ binding protein
ABC-type Mn2+/Zn2+ transport systems, Zn2+ binding protein
yciC
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -37
score = 5.81558
sequence = TAAATCGTAATCATTCTATTTTA

Gene: BSU03360: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Bacillus amyloliquefaciens FZB42

Site:
position = -38
score = 5.6825
sequence = TAAATCGTAATCATTCTATTTTG

Site:
position = -103
score = 6.64268
sequence = TAAATAGTAACGATTACGATTTA

Gene: RBAM_003550: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Bacillus pumilus SAFR-032

Site:
position = -69
score = 6.57844
sequence = CAAATCGTAATCATTACTTTTTA

Gene: BPUM_3311: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*2
Bacillus licheniformis DSM 13

Site:
position = -46
score = 7.03961
sequence = TAAATCGTAATAATTACGATTTG

Gene: BLi00765: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Site:
position = -38
score = 6.22215
sequence = CAAATCGAAACAATTACGTTTTA

Gene: BLi03212: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Anoxybacillus flavithermus WK1

Site:
position = -40
score = 7.00692
sequence = TAAATCGTAATGATTACGTTTTA

Gene: Aflv_0397: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Geobacillus kaustophilus HTA426
*
Bacillus cereus ATCC 14579

Site:
position = -39
score = 7.00692
sequence = TAAAACGTAATCATTACGATTTA

Site:
position = -93
score = 6.8671
sequence = TAAATCGTAATCATTATGATTTA

Gene: BC1705: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Bacillus halodurans C-125

Site:
position = -54
score = 5.51645
sequence = CAAATCGTAATGATAACTTTTAT

Site:
position = -195
score = 6.66144
sequence = CAAAGCGTAATTATTACGATTTA

Gene: BH1790: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Bacillus clausii KSM-K16

Site:
position = -40
score = 6.90222
sequence = TAATTCGTAATCATTACGATTTA

Gene: ABC4020: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*2
Oceanobacillus iheyensis HTE831

Site:
position = -82
score = 6.34902
sequence = TTAATCGTAATGATTACGTTTTT

Gene: OB3429: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Gene: OB3430: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Paenibacillus sp. JDR-2

Site:
position = -35
score = 5.09107
sequence = TTAATAGTAATGATTACGGAAAA

Gene: Pjdr2_3068: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
rpsN2
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -40
score = 6.57533
sequence = TAAATCGTAACAATTTCGATTTA

Gene: BSU08880: 30S ribosomal protein S14
*
Bacillus amyloliquefaciens FZB42

Site:
position = -37
score = 6.68644
sequence = CAAAACGTAATTATTACGATTTG

Gene: RBAM_009150: 30S ribosomal protein S14
 
Bacillus pumilus SAFR-032

Gene: BPUM_3312: 30S ribosomal protein S14
*
Bacillus licheniformis DSM 13

Site:
position = -44
score = 6.71577
sequence = TAAATCGTAATCATTACGCTTTG

Gene: BLi00952: 30S ribosomal protein S14
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
*
Bacillus clausii KSM-K16

Site:
position = -45
score = 6.09469
sequence = TAAATCGTAATAATAATGATTTT

Gene: ABC4019: 30S ribosomal protein S14
*
Oceanobacillus iheyensis HTE831

Site:
position = -247
score = 6.04491
sequence = TTAATCGTAATCGTTACGATGTA

Gene: OB3432: 30S ribosomal protein S14
 
Paenibacillus sp. JDR-2
30S ribosomal protein S14
OB3431
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831

Gene: OB3431: hypothetical protein
 
Paenibacillus sp. JDR-2
hypothetical protein
 
CRON 5.
folE2
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -44
score = 6.74421
sequence = TAAATAGTAATTATTACGATTTG

Gene: BSU03340: GTP cyclohydrolase I (EC 3.5.4.16) type 2
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
*
Bacillus licheniformis DSM 13

Site:
position = -44
score = 5.99776
sequence = TAAATAGGAACTATTTCGATTTA

Site:
position = -120
score = 5.91306
sequence = CTAAACGAAATCATTTCGATTTA

Gene: BLi00762: GTP cyclohydrolase I (EC 3.5.4.16) type 2
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
*
Bacillus halodurans C-125

Site:
position = -41
score = 6.23521
sequence = TAAATCGTAATTATTCTTATTTA

Gene: BH0998: GTP cyclohydrolase I (EC 3.5.4.16) type 2
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831

Gene: OB1688: GTP cyclohydrolase I (EC 3.5.4.16) type 2
 
Paenibacillus sp. JDR-2
GTP cyclohydrolase I (EC 3.5.4.16) type 2
yciB
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU03350: putative metal uptake system lipoprotein
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
putative metal uptake system lipoprotein
 
CRON 6.
znuC
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
*
Bacillus pumilus SAFR-032

Site:
position = -46
score = 5.41154
sequence = TAAATCGTAATCATTCTTTTTAT

Gene: BPUM_2243: Zinc ABC transporter, ATP-binding protein ZnuC
 
Bacillus licheniformis DSM 13

Gene: BLi02688: Zinc ABC transporter, ATP-binding protein ZnuC
*
Anoxybacillus flavithermus WK1

Site:
position = -36
score = 5.66612
sequence = TGAATCGGAATCATTTTGAATTA

Gene: Aflv_0867: Zinc ABC transporter, ATP-binding protein ZnuC
*
Geobacillus kaustophilus HTA426

Site:
position = -39
score = 5.84489
sequence = CAAATCGGAATGATTCTGAATTA

Gene: GK2471: Zinc ABC transporter, ATP-binding protein ZnuC
*
Bacillus cereus ATCC 14579

Site:
position = -39
score = 5.97797
sequence = TAAATCGGAATCATTCTGAATTA

Gene: BC4279: Zinc ABC transporter, ATP-binding protein ZnuC
*
Bacillus halodurans C-125

Site:
position = -72
score = 5.02467
sequence = TAAATCGGAATGATTCTTAATAT

Gene: BH1394: Zinc ABC transporter, ATP-binding protein ZnuC
*
Bacillus clausii KSM-K16

Site:
position = -39
score = 5.09126
sequence = TAAATCGGAAGCATTCTGAATAA

Gene: ABC1702: Zinc ABC transporter, ATP-binding protein ZnuC
*
Oceanobacillus iheyensis HTE831

Site:
position = -297
score = 6.03573
sequence = TAATTCGTAACGATTCCTATTTA

Site:
position = -274
score = 5.12628
sequence = CATTTCATAATCATTACGCTATT

Gene: OB2396: Zinc ABC transporter, ATP-binding protein ZnuC
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_2275: Zinc ABC transporter, ATP-binding protein ZnuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032

Gene: BPUM_2242: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Bacillus licheniformis DSM 13

Gene: BLi02687: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0868: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Geobacillus kaustophilus HTA426

Gene: GK2470: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Bacillus cereus ATCC 14579

Gene: BC4278: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Bacillus halodurans C-125

Gene: BH1395: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Bacillus clausii KSM-K16

Gene: ABC1703: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Oceanobacillus iheyensis HTE831

Gene: OB2397: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_2276: Zinc ABC transporter, inner membrane permease protein ZnuB
Zinc ABC transporter, inner membrane permease protein ZnuB
zur
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU25100: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_023410: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Bacillus pumilus SAFR-032

Gene: BPUM_2241: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Bacillus licheniformis DSM 13

Gene: BLi02686: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0869: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Geobacillus kaustophilus HTA426

Gene: GK2469: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Bacillus cereus ATCC 14579

Gene: BC4277: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Bacillus halodurans C-125

Gene: BH1396: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Bacillus clausii KSM-K16

Gene: ABC1704: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Oceanobacillus iheyensis HTE831

Gene: OB2398: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_2271: Zinc homeostasis transcriptional regulator Zur, Fur family
Zinc homeostasis transcriptional regulator Zur, Fur family
 
CRON 7.
adcC
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU02860: Mn2+/Zn2+ ABC transporter ATP-binding protein
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_003120: Mn2+/Zn2+ ABC transporter ATP-binding protein
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC1116: Mn2+/Zn2+ ABC transporter ATP-binding protein
 
Oceanobacillus iheyensis HTE831
*
Paenibacillus sp. JDR-2

Site:
position = -67
score = 5.78657
sequence = CTAATCGTAATAGTTACGAAATA

Site:
position = -118
score = 5.17062
sequence = TTATACGTAATTATTACGTTCAA

Site:
position = -162
score = 5.59229
sequence = TTAATCGTAATGTTGACGATTAA

Gene: Pjdr2_3065: Mn2+/Zn2+ ABC transporter ATP-binding protein
Mn2+/Zn2+ ABC transporter ATP-binding protein
adcB
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU02870: Mn2+/Zn2+ ABC transporter permease
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_003130: Mn2+/Zn2+ ABC transporter permease
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC1115: Mn2+/Zn2+ ABC transporter permease
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_3066: Mn2+/Zn2+ ABC transporter permease
Mn2+/Zn2+ ABC transporter permease
adcA
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -52
score = 5.84059
sequence = AAAATCGTTATCATTTTGATTTA

Site:
position = -92
score = 5.56824
sequence = CAAAACGTAATGACTTCGGTTTA

Gene: BSU02850: Mn2+/Zn2+ ABC transporter Zn(II)-binding lipoprotein
*
Bacillus amyloliquefaciens FZB42

Site:
position = -42
score = 5.51697
sequence = GAAATCGTCATCATTCTGATTTA

Site:
position = -105
score = 5.82634
sequence = CAAAACGTAATTACTTCGTTTTA

Gene: RBAM_003110: Mn2+/Zn2+ ABC transporter Zn(II)-binding lipoprotein
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC1117: Mn2+/Zn2+ ABC transporter Zn(II)-binding lipoprotein
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_3067: Mn2+/Zn2+ ABC transporter Zn(II)-binding lipoprotein
Mn2+/Zn2+ ABC transporter Zn(II)-binding lipoprotein
yciC
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
*
Paenibacillus sp. JDR-2

Site:
position = -35
score = 5.09107
sequence = TTAATAGTAATGATTACGGAAAA

Gene: Pjdr2_3068: putitative GTPase
putitative GTPase
zinT
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -42
score = 6.53014
sequence = TAAATCGTAATGTTTTCGATTTA

Gene: BSU26830: candidate zinc-binding lipoprotein
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
*2
Bacillus clausii KSM-K16

Site:
position = -54
score = 6.81952
sequence = CAAAACGTAATAATTACGATTTA

Gene: ABC1118: candidate zinc-binding lipoprotein

Site:
position = -54
score = 6.81952
sequence = CAAAACGTAATAATTACGATTTA

Gene: ABC1118: candidate zinc-binding lipoprotein
*
Oceanobacillus iheyensis HTE831

Site:
position = -41
score = 5.95492
sequence = CGAATCGTAATCATTACGATTAC

Site:
position = -57
score = 6.19462
sequence = TAAATCGTAACCATTACGAATCG

Gene: OB1278: candidate zinc-binding lipoprotein
 
Paenibacillus sp. JDR-2
candidate zinc-binding lipoprotein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD