Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog YtrA - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Ramoplanin resistance
Effector: Ramoplanin
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 9 2
Bacillus amyloliquefaciens FZB42 7 1
Bacillus pumilus SAFR-032 5 1
Bacillus licheniformis DSM 13 5 1
Anoxybacillus flavithermus WK1 3 1
Geobacillus kaustophilus HTA426 3 1
Bacillus cereus ATCC 14579 4 1
Bacillus halodurans C-125
Bacillus clausii KSM-K16
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ytrA
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -244
score = 6.47264
sequence = TGTACTAATTGAAGTAATACA

Gene: BSU30460: Transcriptional regulator, GntR family
*
Bacillus amyloliquefaciens FZB42

Site:
position = -238
score = 6.72078
sequence = TGTACTACTTGATGTAATACA

Gene: RBAM_027400: Transcriptional regulator, GntR family
*
Bacillus pumilus SAFR-032

Site:
position = -234
score = 6.42666
sequence = TGTACTACATCAACTAATACA

Gene: BPUM_2677: Transcriptional regulator, GntR family
*
Bacillus licheniformis DSM 13

Site:
position = -223
score = 6.39037
sequence = TGTACTACATCGAGTAATACA

Gene: BLi03185: Transcriptional regulator, GntR family
*
Anoxybacillus flavithermus WK1

Site:
position = -60
score = 6.09431
sequence = CGTATTATTTAATATAATACA

Gene: Aflv_1397: Transcriptional regulator, GntR family
*
Geobacillus kaustophilus HTA426

Site:
position = -49
score = 5.85254
sequence = TGTACTATTAGTTATAGTACG

Gene: GK1620: Transcriptional regulator, GntR family
*
Bacillus cereus ATCC 14579

Site:
position = -46
score = 6.39889
sequence = TGTATTACATATAGTAGTACA

Gene: BC4076: Transcriptional regulator, GntR family
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Transcriptional regulator, GntR family
ytrB
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU30450: ABC-type multidrug transport system, ATPase component
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_027390: ABC-type multidrug transport system, ATPase component
 
Bacillus pumilus SAFR-032

Gene: BPUM_2676: ABC-type multidrug transport system, ATPase component
 
Bacillus licheniformis DSM 13

Gene: BLi03184: ABC-type multidrug transport system, ATPase component
 
Anoxybacillus flavithermus WK1

Gene: Aflv_1398: ABC-type multidrug transport system, ATPase component
 
Geobacillus kaustophilus HTA426

Gene: GK1621: ABC-type multidrug transport system, ATPase component
 
Bacillus cereus ATCC 14579

Gene: BC4077: ABC-type multidrug transport system, ATPase component
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
ABC-type multidrug transport system, ATPase component
ytrC
 2
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU30440: ABC-type multidrug transport system, permease component

Gene: BSU30430: ABC-type multidrug transport system, permease component
 3
Bacillus amyloliquefaciens FZB42

Gene: RBAM_027380: ABC-type multidrug transport system, permease component

Gene: RBAM_027370: ABC-type multidrug transport system, permease component

Gene: RBAM_027360: ABC-type multidrug transport system, permease component
 
Bacillus pumilus SAFR-032

Gene: BPUM_2675: ABC-type multidrug transport system, permease component
 
Bacillus licheniformis DSM 13

Gene: BLi03183: ABC-type multidrug transport system, permease component
 
Anoxybacillus flavithermus WK1

Gene: Aflv_1399: ABC-type multidrug transport system, permease component
 
Geobacillus kaustophilus HTA426

Gene: GK1622: ABC-type multidrug transport system, permease component
 2
Bacillus cereus ATCC 14579

Gene: BC4079: ABC-type multidrug transport system, permease component

Gene: BC4078: ABC-type multidrug transport system, permease component
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
ABC-type multidrug transport system, permease component
ytrE
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU30420: ABC transporter, ATP-binding protein
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_027350: ABC transporter, ATP-binding protein
 
Bacillus pumilus SAFR-032

Gene: BPUM_2674: ABC transporter, ATP-binding protein
 
Bacillus licheniformis DSM 13

Gene: BLi03182: ABC transporter, ATP-binding protein
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
ABC transporter, ATP-binding protein
ytrF
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU30410: ABC transporter, permease protein
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_027340: ABC transporter, permease protein
 
Bacillus pumilus SAFR-032

Gene: BPUM_2673: ABC transporter, permease protein
 
Bacillus licheniformis DSM 13

Gene: BLi03181: ABC transporter, permease protein
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
ABC transporter, permease protein
 
CRON 2.
ywoB
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -34
score = 6.61195
sequence = TGTACTACATCAAATAATACA

Gene: BSU36500: Putative integral inner membrane protein
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Putative integral inner membrane protein
ywoC
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU36490: Nicotinamidase/isochorismatase family protein
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_033670: Nicotinamidase/isochorismatase family protein
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Nicotinamidase/isochorismatase family protein
ywoD
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU36480: drug resistance transporter, EmrB/QacA family
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_033660: drug resistance transporter, EmrB/QacA family
 
Bacillus pumilus SAFR-032

Gene: BPUM_3295: drug resistance transporter, EmrB/QacA family
 
Bacillus licheniformis DSM 13

Gene: BLi04075: drug resistance transporter, EmrB/QacA family
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_3092: drug resistance transporter, EmrB/QacA family
drug resistance transporter, EmrB/QacA family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD