Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Rex - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: Rex
Regulation mode: repressor
Biological process: Energy metabolism
Effector: NADH
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 64 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 10 5
Bacillus amyloliquefaciens FZB42 8 4
Bacillus pumilus SAFR-032 9 3
Bacillus licheniformis DSM 13 12 7
Anoxybacillus flavithermus WK1 10 6
Geobacillus kaustophilus HTA426 3 3
Bacillus cereus ATCC 14579 9 5
Bacillus halodurans C-125 2 1
Bacillus clausii KSM-K16 3 3
Oceanobacillus iheyensis HTE831 8 4
Paenibacillus sp. JDR-2 7 4
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ndh2
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU32100: NADH dehydrogenase (EC 1.6.99.3)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_029150: NADH dehydrogenase (EC 1.6.99.3)
 
Bacillus pumilus SAFR-032

Gene: BPUM_2872: NADH dehydrogenase (EC 1.6.99.3)
*
Bacillus licheniformis DSM 13

Site:
position = -119
score = 4.91014
sequence = AAAGTGAAGGGTTTCACAAA

Gene: BLi03392: NADH dehydrogenase (EC 1.6.99.3)
*
Anoxybacillus flavithermus WK1

Site:
position = -76
score = 5.48963
sequence = TTCGTGAATAAATTCACAAA

Gene: Aflv_2402: NADH dehydrogenase (EC 1.6.99.3)
*
Geobacillus kaustophilus HTA426

Site:
position = -102
score = 5.55038
sequence = AACGTGAATTATTTCACAAA

Gene: GK2953: NADH dehydrogenase (EC 1.6.99.3)
 
Bacillus cereus ATCC 14579

Gene: BC4925: NADH dehydrogenase (EC 1.6.99.3)
 
Bacillus halodurans C-125

Gene: BH3407: NADH dehydrogenase (EC 1.6.99.3)
*
Bacillus clausii KSM-K16

Site:
position = -55
score = 4.76869
sequence = AAAGTGAAATGAATCACAAA

Gene: ABC2924: NADH dehydrogenase (EC 1.6.99.3)
 
Oceanobacillus iheyensis HTE831

Gene: OB2350: NADH dehydrogenase (EC 1.6.99.3)
*
Paenibacillus sp. JDR-2

Site:
position = -64
score = 5.72113
sequence = ATTGTGTAATTTTTCACAAA

Gene: Pjdr2_4834: NADH dehydrogenase (EC 1.6.99.3)
NADH dehydrogenase (EC 1.6.99.3)
 
CRON 2.
yndG
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU17780: Hypothetical protein
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_018020: Hypothetical protein
*
Bacillus pumilus SAFR-032

Site:
position = -35
score = 5.51794
sequence = TATGTGAAACAATTCACATA

Gene: BPUM_1837: Hypothetical protein
*
Bacillus licheniformis DSM 13

Site:
position = -32
score = 5.82995
sequence = ATTGTGAATATATTCACAAA

Gene: BLi02193: Hypothetical protein
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
*
Bacillus cereus ATCC 14579

Site:
position = -71
score = 4.99187
sequence = TTTGTGAAAAATGTAGCAAA

Gene: BC1749: Hypothetical protein
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831

Gene: OB0728: Hypothetical protein
 
Paenibacillus sp. JDR-2
Hypothetical protein
yndH
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU17790: Hypothetical protein
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_018030: Hypothetical protein
 
Bacillus pumilus SAFR-032

Gene: BPUM_1836: Hypothetical protein
 
Bacillus licheniformis DSM 13

Gene: BLi02192: Hypothetical protein
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC1750: Hypothetical protein
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831

Gene: OB0729: Hypothetical protein
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_2731: Hypothetical protein
Hypothetical protein
yndJ
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU17800: Putative integral inner membrane protein
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_018040: Putative integral inner membrane protein
 
Bacillus pumilus SAFR-032

Gene: BPUM_1835: Putative integral inner membrane protein
 
Bacillus licheniformis DSM 13

Gene: BLi02191: Putative integral inner membrane protein
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC1751: Putative integral inner membrane protein
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831

Gene: OB0730: Putative integral inner membrane protein
 
Paenibacillus sp. JDR-2
Putative integral inner membrane protein
 
CRON 3.
yjlC
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -113
score = 5.95929
sequence = ATTGTGCATGAATTCACAAT

Gene: BSU12280: Hypothetical protein
*
Bacillus amyloliquefaciens FZB42

Site:
position = -110
score = 5.95929
sequence = ATTGTGCATGAATTCACAAT

Gene: RBAM_012360: Hypothetical protein
 
Bacillus pumilus SAFR-032
*
Bacillus licheniformis DSM 13

Site:
position = -80
score = 6.00858
sequence = TTTGTGCATAAATTCACAAA

Gene: BLi02135: Hypothetical protein
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
*
Bacillus cereus ATCC 14579

Site:
position = -82
score = 4.79697
sequence = TTTGTGAAACTTTGTATAAA

Gene: BC5060: Hypothetical protein
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
*
Paenibacillus sp. JDR-2

Site:
position = -97
score = 5.42153
sequence = ATTGTGAATAATTTCACTTT

Gene: Pjdr2_6270: Hypothetical protein
Hypothetical protein
ndh
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU12290: NADH dehydrogenase (EC 1.6.99.3)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_012370: NADH dehydrogenase (EC 1.6.99.3)
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi02134: NADH dehydrogenase (EC 1.6.99.3)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC5061: NADH dehydrogenase (EC 1.6.99.3)
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_6269: NADH dehydrogenase (EC 1.6.99.3)
NADH dehydrogenase (EC 1.6.99.3)
 
CRON 4.
ydbI
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -68
score = 5.08404
sequence = TTTGTTATATAATTTACAAA

Gene: BSU04480: Putative integral inner membrane protein
*
Bacillus amyloliquefaciens FZB42

Site:
position = -73
score = 5.1022
sequence = TTTGTTATATAATTTACAAT

Gene: RBAM_004810: Putative integral inner membrane protein
 
Bacillus pumilus SAFR-032

Gene: BPUM_0420: Putative integral inner membrane protein
 
Bacillus licheniformis DSM 13

Gene: BLi00535: Putative integral inner membrane protein
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Putative integral inner membrane protein
 
CRON 5.
qoxA
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU38170: Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_035430: Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3464: Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-)
 
Bacillus licheniformis DSM 13

Gene: BLi04040: Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-)
*
Anoxybacillus flavithermus WK1

Site:
position = -36
score = 5.16939
sequence = TTTGTTCAATGAATCACAAT

Gene: Aflv_0272: Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-)
 
Geobacillus kaustophilus HTA426

Gene: GK3459: Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-)
 
Bacillus cereus ATCC 14579

Gene: BC0698: Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-)
 
Bacillus halodurans C-125

Gene: BH2064: Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-)
 
Bacillus clausii KSM-K16

Gene: ABC2137: Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-)
*
Oceanobacillus iheyensis HTE831

Site:
position = -123
score = 5.43368
sequence = TTTGTGAAGCATTTCTCAAA

Gene: OB2253: Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-)
 
Paenibacillus sp. JDR-2
Cytochrome aa3-600 quinol oxidase (subunit II) (EC 1.9.3.-)
qoxB
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU38160: Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_035420: Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3463: Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-)
 
Bacillus licheniformis DSM 13

Gene: BLi04039: Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0273: Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-)
 
Geobacillus kaustophilus HTA426

Gene: GK3458: Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-)
 
Bacillus cereus ATCC 14579

Gene: BC0697: Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-)
 
Bacillus halodurans C-125

Gene: BH2065: Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-)
 
Bacillus clausii KSM-K16

Gene: ABC2136: Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-)
 
Oceanobacillus iheyensis HTE831

Gene: OB2254: Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-)
 
Paenibacillus sp. JDR-2
Cytochrome aa3-600 quinol oxidase (subunit I) (EC 1.9.3.-)
qoxC
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU38150: Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_035410: Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3462: Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-)
 
Bacillus licheniformis DSM 13

Gene: BLi04038: Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0274: Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-)
 
Geobacillus kaustophilus HTA426

Gene: GK3457: Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-)
 
Bacillus cereus ATCC 14579

Gene: BC0696: Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-)
 
Bacillus halodurans C-125

Gene: BH2066: Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-)
 
Bacillus clausii KSM-K16

Gene: ABC2135: Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-)
 
Oceanobacillus iheyensis HTE831

Gene: OB2255: Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-)
 
Paenibacillus sp. JDR-2
Cytochrome aa3-600 quinol oxidase (subunit III) (EC 1.9.3.-)
qoxD
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU38140: Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_035400: Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3461: Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-)
 
Bacillus licheniformis DSM 13

Gene: BLi04037: Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0275: Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-)
 
Geobacillus kaustophilus HTA426

Gene: GK3456: Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-)
 
Bacillus cereus ATCC 14579

Gene: BC0695: Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-)
 
Bacillus halodurans C-125

Gene: BH2067: Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-)
 
Bacillus clausii KSM-K16

Gene: ABC2134: Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-)
 
Oceanobacillus iheyensis HTE831

Gene: OB2256: Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-)
 
Paenibacillus sp. JDR-2
Cytochrome aa3-600 quinol oxidase (subunit IV) (EC 1.9.3.-)
 
CRON 6.
pflB
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
*
Bacillus licheniformis DSM 13

Site:
position = -119
score = 5.96302
sequence = TTTGTTAACTATTTCACAAA

Gene: BLi02132: Pyruvate formate-lyase (EC 2.3.1.54)
*
Anoxybacillus flavithermus WK1

Site:
position = -117
score = 4.96646
sequence = TTTGATCAACTTTTCACAAA

Gene: Aflv_2793: Pyruvate formate-lyase (EC 2.3.1.54)
 
Geobacillus kaustophilus HTA426
*
Bacillus cereus ATCC 14579

Site:
position = -129
score = 5.47832
sequence = TTTGCTCAACATTTCACAAA

Gene: BC0491: Pyruvate formate-lyase (EC 2.3.1.54)
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Pyruvate formate-lyase (EC 2.3.1.54)
pflA
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi02131: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2794: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC0492: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_5251: Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
Pyruvate formate-lyase activating enzyme (EC 1.97.1.4)
 
CRON 7.
nirS
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
*
Geobacillus kaustophilus HTA426

Site:
position = -122
score = 5.73305
sequence = ATTGCTCATTATTTCACAAA

Gene: GK0767: Copper-containing nitrite reductase (EC 1.7.2.1)
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Copper-containing nitrite reductase (EC 1.7.2.1)
 
CRON 8.
ldh
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -62
score = 6.0433
sequence = AATGTGAAATACTTCACAAA

Site:
position = -85
score = 5.96092
sequence = TTTGTGAAGTGTTGCACAAT

Gene: BSU03050: L-lactate dehydrogenase (EC 1.1.1.27)
*
Bacillus amyloliquefaciens FZB42

Site:
position = -59
score = 5.56352
sequence = AATGTGAAATACTTCACAAG

Site:
position = -82
score = 6.26873
sequence = TTTGTGAAGTATTGCACAAT

Gene: RBAM_003290: L-lactate dehydrogenase (EC 1.1.1.27)
*
Bacillus pumilus SAFR-032

Site:
position = -56
score = 5.74408
sequence = AATGTGAAATACTTCACATA

Site:
position = -79
score = 6.26873
sequence = TTTGTGAAGTATTGCACAAT

Gene: BPUM_0277: L-lactate dehydrogenase (EC 1.1.1.27)
*
Bacillus licheniformis DSM 13

Site:
position = -59
score = 5.77272
sequence = AATGTGAAGAATTTCACAAA

Site:
position = -82
score = 5.9695
sequence = TATGTGAAGTATTGCACAAT

Gene: BLi00366: L-lactate dehydrogenase (EC 1.1.1.27)
*
Anoxybacillus flavithermus WK1

Site:
position = -58
score = 5.44466
sequence = TTTGTGAAACAGTGTACAAT

Gene: Aflv_0889: L-lactate dehydrogenase (EC 1.1.1.27)
*
Geobacillus kaustophilus HTA426

Site:
position = -42
score = 5.53073
sequence = AATGTGAATATATTCACAAA

Gene: GK0475: L-lactate dehydrogenase (EC 1.1.1.27)
 
Bacillus cereus ATCC 14579
*
Bacillus halodurans C-125

Site:
position = -44
score = 5.10401
sequence = CATGTGAAAATATTCACAAA

Site:
position = -219
score = 5.71641
sequence = CATGTGAAATATTTCACAAA

Site:
position = -276
score = 6.21435
sequence = AATGTGAAATATTTCACAAA

Gene: BH3937: L-lactate dehydrogenase (EC 1.1.1.27)
*
Bacillus clausii KSM-K16

Site:
position = -45
score = 5.87254
sequence = AATGTGAATAATTTCACAAA

Site:
position = -68
score = 6.36855
sequence = TTTGTGAAATAATGCACAAT

Gene: ABC2872: L-lactate dehydrogenase (EC 1.1.1.27)
*
Oceanobacillus iheyensis HTE831

Site:
position = -68
score = 6.51357
sequence = TTTGTGAAATATTTCACAAT

Gene: OB3279: L-lactate dehydrogenase (EC 1.1.1.27)
 
Paenibacillus sp. JDR-2
L-lactate dehydrogenase (EC 1.1.1.27)
lctP
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU03060: L-lactate permease
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032

Gene: BPUM_0278: L-lactate permease
 
Bacillus licheniformis DSM 13

Gene: BLi00367: L-lactate permease
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH3936: L-lactate permease
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
L-lactate permease
 
CRON 9.
cydA
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -53
score = 5.37656
sequence = TTTGTGAAGTAGTGAGCAAA

Site:
position = -85
score = 5.30258
sequence = TTTGTGAATTACTGATCAAA

Site:
position = -120
score = 5.80428
sequence = TTTGTGAAATATTGAGCAAT

Gene: BSU38760: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
*
Bacillus amyloliquefaciens FZB42

Site:
position = -44
score = 5.49647
sequence = TTTGTGAAATGTTGAGCAAT

Site:
position = -76
score = 5.03577
sequence = TTTGTGAAATACCGAGCAAT

Site:
position = -106
score = 5.47832
sequence = TTTGTGAAACATTGAGCAAA

Gene: RBAM_036010: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
*
Bacillus pumilus SAFR-032

Site:
position = -68
score = 4.76953
sequence = TTTGTGAAGTGGTGAGCATA

Site:
position = -98
score = 5.58141
sequence = TTTGTGAACCATTGAACAAA

Gene: BPUM_3519: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
 
Bacillus licheniformis DSM 13

Gene: BLi04134: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC1938: Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Cytochrome d ubiquinol oxidase subunit I (EC 1.10.3.-)
cydB
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU38750: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_036000: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3518: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
 
Bacillus licheniformis DSM 13

Gene: BLi04133: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC1939: Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Cytochrome d ubiquinol oxidase subunit II (EC 1.10.3.-)
cydC
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU38740: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_035990: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function
 
Bacillus pumilus SAFR-032

Gene: BPUM_3517: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function
 
Bacillus licheniformis DSM 13

Gene: BLi04132: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC1940: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function
 
Bacillus halodurans C-125

Gene: BH3971: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831

Gene: OB1047: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function
 
Paenibacillus sp. JDR-2
ABC membrane transporter (ATP-binding protein) required for cytochrome bd function
cydD
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU38730: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_035980: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function
 
Bacillus pumilus SAFR-032

Gene: BPUM_3516: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function
 
Bacillus licheniformis DSM 13

Gene: BLi04131: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC1941: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function
 
Bacillus halodurans C-125

Gene: BH3972: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831

Gene: OB1048: ABC membrane transporter (ATP-binding protein) required for cytochrome bd function
 
Paenibacillus sp. JDR-2
ABC membrane transporter (ATP-binding protein) required for cytochrome bd function
 
CRON 10.
coxA
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1

Gene: Aflv_1360: Cytochrome c oxidase (B(O/a)3-type) chain II (EC 1.9.3.1)
 
Geobacillus kaustophilus HTA426

Gene: GK1547: Cytochrome c oxidase (B(O/a)3-type) chain II (EC 1.9.3.1)
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH0740: Cytochrome c oxidase (B(O/a)3-type) chain II (EC 1.9.3.1)
 
Bacillus clausii KSM-K16
*
Oceanobacillus iheyensis HTE831

Site:
position = -254
score = 5.71212
sequence = TTTGTGCATAATTGAACAAA

Gene: OB1745: Cytochrome c oxidase (B(O/a)3-type) chain II (EC 1.9.3.1)
 
Paenibacillus sp. JDR-2
Cytochrome c oxidase (B(O/a)3-type) chain II (EC 1.9.3.1)
coxB
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1

Gene: Aflv_1359: Cytochrome c oxidase (B(O/a)3-type) chain I (EC 1.9.3.1)
 
Geobacillus kaustophilus HTA426

Gene: GK1546: Cytochrome c oxidase (B(O/a)3-type) chain I (EC 1.9.3.1)
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH0739: Cytochrome c oxidase (B(O/a)3-type) chain I (EC 1.9.3.1)
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831

Gene: OB1746: Cytochrome c oxidase (B(O/a)3-type) chain I (EC 1.9.3.1)
 
Paenibacillus sp. JDR-2
Cytochrome c oxidase (B(O/a)3-type) chain I (EC 1.9.3.1)
 
CRON 11.
adhB
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_017440: Alcohol dehydrogenase (EC 1.1.1.1), Zn-dependent
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
*
Bacillus cereus ATCC 14579

Site:
position = -163
score = 5.80408
sequence = ATTGTTCATAATTTCACAAA

Gene: BC2220: Alcohol dehydrogenase (EC 1.1.1.1), Zn-dependent
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Alcohol dehydrogenase (EC 1.1.1.1), Zn-dependent
 
CRON 12.
adhE
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
*
Bacillus licheniformis DSM 13

Site:
position = -92
score = 5.70783
sequence = CTTGTGAAATGTTTCACAAA

Site:
position = -216
score = 5.81993
sequence = TTTGTTCAACATTTCACAAA

Gene: BLi04290: Alcohol dehydrogenase (EC 1.1.1.1), Fe-dependent; Acetaldehyde dehydrogenase (EC 1.2.1.10)
*
Anoxybacillus flavithermus WK1

Site:
position = -97
score = 5.47832
sequence = TTTGCTCAATGTTTCACAAA

Site:
position = -445
score = 6.14589
sequence = TTTGTTCAATATTTCACAAT

Gene: Aflv_2814: Alcohol dehydrogenase (EC 1.1.1.1), Fe-dependent; Acetaldehyde dehydrogenase (EC 1.2.1.10)
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Alcohol dehydrogenase (EC 1.1.1.1), Fe-dependent; Acetaldehyde dehydrogenase (EC 1.2.1.10)
 
CRON 13.
noxE
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
*
Bacillus clausii KSM-K16

Site:
position = -41
score = 4.79529
sequence = CTTGTGAAATTACTCACATT

Site:
position = -72
score = 5.2398
sequence = TTTGCTCAATGGTTCACAAA

Site:
position = -114
score = 5.01945
sequence = TTTGCTCACCAGTTCACAAT

Gene: ABC1842: NADH oxidase (EC 1.6.99.3)
*
Oceanobacillus iheyensis HTE831

Site:
position = -44
score = 5.66704
sequence = ATTGTGAAATGCTGAACAAA

Site:
position = -111
score = 5.72241
sequence = ATTGTGAAAAACTGAACAAT

Gene: OB3312: NADH oxidase (EC 1.6.99.3)
*
Paenibacillus sp. JDR-2

Site:
position = -42
score = 4.79688
sequence = TATGTGAATAATTTCACAGG

Site:
position = -207
score = 5.79341
sequence = ATTGTGAATTAATTCACACA

Site:
position = -273
score = 4.77713
sequence = TATGTGAAATTAATCACAAC

Gene: Pjdr2_2160: NADH oxidase (EC 1.6.99.3)
NADH oxidase (EC 1.6.99.3)
 
CRON 14.
nadA
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU27850: Quinolinate synthetase (EC 4.1.99.-)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_024900: Quinolinate synthetase (EC 4.1.99.-)
 
Bacillus pumilus SAFR-032

Gene: BPUM_2425: Quinolinate synthetase (EC 4.1.99.-)
 
Bacillus licheniformis DSM 13

Gene: BLi02912: Quinolinate synthetase (EC 4.1.99.-)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0705: Quinolinate synthetase (EC 4.1.99.-)
 
Geobacillus kaustophilus HTA426

Gene: GK2599: Quinolinate synthetase (EC 4.1.99.-)
 
Bacillus cereus ATCC 14579

Gene: BC4421: Quinolinate synthetase (EC 4.1.99.-)
 
Bacillus halodurans C-125

Gene: BH1220: Quinolinate synthetase (EC 4.1.99.-)
 
Bacillus clausii KSM-K16

Gene: ABC1549: Quinolinate synthetase (EC 4.1.99.-)
 
Oceanobacillus iheyensis HTE831
*
Paenibacillus sp. JDR-2

Site:
position = -84
score = 5.97136
sequence = TTTGTGCATCAATTCACAAA

Gene: Pjdr2_0068: Quinolinate synthetase (EC 4.1.99.-)
Quinolinate synthetase (EC 4.1.99.-)
nadB
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU27870: L-aspartate oxidase (EC 1.4.3.16)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_024920: L-aspartate oxidase (EC 1.4.3.16)
 
Bacillus pumilus SAFR-032

Gene: BPUM_2427: L-aspartate oxidase (EC 1.4.3.16)
 
Bacillus licheniformis DSM 13

Gene: BLi02914: L-aspartate oxidase (EC 1.4.3.16)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0703: L-aspartate oxidase (EC 1.4.3.16)
 
Geobacillus kaustophilus HTA426

Gene: GK2601: L-aspartate oxidase (EC 1.4.3.16)
 
Bacillus cereus ATCC 14579

Gene: BC4423: L-aspartate oxidase (EC 1.4.3.16)
 
Bacillus halodurans C-125

Gene: BH1218: L-aspartate oxidase (EC 1.4.3.16)
 
Bacillus clausii KSM-K16

Gene: ABC1547: L-aspartate oxidase (EC 1.4.3.16)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0069: L-aspartate oxidase (EC 1.4.3.16)
L-aspartate oxidase (EC 1.4.3.16)
nadC
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU27860: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_024910: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Bacillus pumilus SAFR-032

Gene: BPUM_2426: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Bacillus licheniformis DSM 13

Gene: BLi02913: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0704: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Geobacillus kaustophilus HTA426

Gene: GK2600: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Bacillus cereus ATCC 14579

Gene: BC4422: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Bacillus halodurans C-125

Gene: BH1219: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Bacillus clausii KSM-K16

Gene: ABC1548: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0070: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
 
CRON 15.
ywcJ
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -66
score = 6.36068
sequence = ATTGTGAAATACTTCACAAT

Gene: BSU38060: Formate/nitrite family of transporters
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
*
Bacillus licheniformis DSM 13

Site:
position = -89
score = 6.20577
sequence = TTTGTGAAATGTTTCACAAT

Gene: BLi04135: Formate/nitrite family of transporters
*
Anoxybacillus flavithermus WK1

Site:
position = -43
score = 4.89676
sequence = AGTGTGAAAAACATCACAAA

Gene: Aflv_1436: Nitrite transporter
 
Geobacillus kaustophilus HTA426
*
Bacillus cereus ATCC 14579

Site:
position = -103
score = 6.11381
sequence = TTTGTGAAACATTGCACAAA

Gene: BC1308: Formate/nitrite family of transporters
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Formate/nitrite family of transporters
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD