Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog MntR - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: DtxR
Regulation mode: repressor (activator)
Biological process: Manganese homeostasis
Effector: Manganese ion, (Mn2+)
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 5 2
Bacillus amyloliquefaciens FZB42 1 1
Bacillus pumilus SAFR-032 4 2
Bacillus licheniformis DSM 13 1 1
Anoxybacillus flavithermus WK1 4 1
Geobacillus kaustophilus HTA426 1 1
Bacillus cereus ATCC 14579 4 2
Bacillus halodurans C-125 3 2
Bacillus clausii KSM-K16 4 1
Oceanobacillus iheyensis HTE831 4 1
Paenibacillus sp. JDR-2 4 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
mntA
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -131
score = 5.7439
sequence = AATTTTGCATGAGGGAAACTTT

Gene: BSU30770: Manganase ABC transporter (binding protein)
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032

Gene: BPUM_3013: Manganase ABC transporter (binding protein)
 
Bacillus licheniformis DSM 13

Gene: BLi03547: Manganase ABC transporter (binding protein)
*
Anoxybacillus flavithermus WK1

Site:
position = -92
score = 6.00787
sequence = TATGTTGCATTGAGGAAACTTT

Gene: Aflv_1289: Manganase ABC transporter (binding protein)
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
*
Bacillus halodurans C-125

Site:
position = -54
score = 5.52868
sequence = TGTTTTGCCTTGGGGAAACTTT

Gene: BH0516: Manganase ABC transporter (binding protein)
*
Bacillus clausii KSM-K16

Site:
position = -99
score = 6.02295
sequence = AAAGTTGCATTAGAGAAACTTT

Gene: ABC3961: Manganase ABC transporter (binding protein)
*
Oceanobacillus iheyensis HTE831

Site:
position = -38
score = 5.89598
sequence = AAAGTTTACCTAAGGCAAAATT

Site:
position = -123
score = 5.57785
sequence = AAAGTTTCCTTAGTGCAAAAAA

Gene: OB0431: Manganase ABC transporter (binding protein)
*
Paenibacillus sp. JDR-2

Site:
position = -109
score = 5.50415
sequence = AATGTTGCATCAGAGAAACATT

Gene: Pjdr2_4868: Manganase ABC transporter (binding protein)
Manganase ABC transporter (binding protein)
mntB
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU30760: Manganese ABC transporter (ATP-binding protein)
 
Bacillus amyloliquefaciens FZB42
*
Bacillus pumilus SAFR-032

Site:
position = -119
score = 5.84273
sequence = AAAGTTTCCCTAAGGAAACAAA

Gene: BPUM_3011: Manganese ABC transporter (ATP-binding protein)
 
Bacillus licheniformis DSM 13

Gene: BLi03545: Manganese ABC transporter (ATP-binding protein)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_1290: Manganese ABC transporter (ATP-binding protein)
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
*
Bacillus halodurans C-125

Site:
position = -180
score = 6.19625
sequence = AAAGTTTACTTAGGGAAACTTT

Gene: BH1389: Manganese ABC transporter (ATP-binding protein)
 
Bacillus clausii KSM-K16

Gene: ABC3960: Manganese ABC transporter (ATP-binding protein)
 
Oceanobacillus iheyensis HTE831

Gene: OB0432: Manganese ABC transporter (ATP-binding protein)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_4867: Manganese ABC transporter (ATP-binding protein)
Manganese ABC transporter (ATP-binding protein)
mntC
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU30750: Manganese ABC transporter (permease)
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1

Gene: Aflv_1291: Manganese ABC transporter (permease)
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC3959: Manganese ABC transporter (permease)
 
Oceanobacillus iheyensis HTE831

Gene: OB0433: Manganese ABC transporter (permease)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_4866: Manganese ABC transporter (permease)
Manganese ABC transporter (permease)
mntD
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU30740: Manganese ABC transporter (permease)
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032

Gene: BPUM_3012: Manganese ABC transporter (permease)
 
Bacillus licheniformis DSM 13

Gene: BLi03546: Manganese ABC transporter (permease)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_1292: Manganese ABC transporter (permease)
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH1390: Manganese ABC transporter (permease)
 
Bacillus clausii KSM-K16

Gene: ABC3958: Manganese ABC transporter (permease)
 
Oceanobacillus iheyensis HTE831

Gene: OB0434: Manganese ABC transporter (permease)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_4865: Manganese ABC transporter (permease)
Manganese ABC transporter (permease)
 
CRON 2.
feoA
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426

Gene: GK1484: Ferrous iron transport protein A
*
Bacillus cereus ATCC 14579

Site:
position = -61
score = 5.8134
sequence = AAAGTTTACCTTAGGAAACTTT

Gene: BC0709: Ferrous iron transport protein A
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Ferrous iron transport protein A
feoB1
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426

Gene: GK1483: Ferrous iron transport protein B
 
Bacillus cereus ATCC 14579

Gene: BC0708: Ferrous iron transport protein B
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Ferrous iron transport protein B
feoB2
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426

Gene: GK1482: Ferrous iron transport protein B
 
Bacillus cereus ATCC 14579

Gene: BC0707: Ferrous iron transport protein B
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Ferrous iron transport protein B
 
CRON 3.
mntH
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -60
score = 6.04748
sequence = TAATTTGCCTTAAGGAAACTCT

Gene: BSU04360: Manganese transport protein MntH
*
Bacillus amyloliquefaciens FZB42

Site:
position = -65
score = 5.6604
sequence = TAATTTGCATCTAGGAAACTTT

Gene: RBAM_004660: Manganese transport protein MntH
*
Bacillus pumilus SAFR-032

Site:
position = -63
score = 5.79435
sequence = AAAATTGCATCAAGGAAACATT

Gene: BPUM_0413: Manganese transport protein MntH
*
Bacillus licheniformis DSM 13

Site:
position = -62
score = 6.27185
sequence = AAATTTGCACTAAGGAAACTTT

Gene: BLi00526: Manganese transport protein MntH
 
Anoxybacillus flavithermus WK1
*
Geobacillus kaustophilus HTA426

Site:
position = -53
score = 6.12675
sequence = AAAGTTTCCTTAATGCAAAATA

Gene: GK0583: Manganese transport protein MntH
*
Bacillus cereus ATCC 14579

Site:
position = -129
score = 6.27185
sequence = TAATTTGCATTAAGGAAACTTT

Gene: BC1803: Manganese transport protein MntH
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Manganese transport protein MntH
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD