Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ManR - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: BglG
Regulation mode: activator
Biological process: Mannose utilization
Effector: ManP, mannose-specific enzyme IIBCA PTS component; HPr, phosphocarrier protein
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 3 2
Bacillus amyloliquefaciens FZB42 3 2
Bacillus pumilus SAFR-032
Bacillus licheniformis DSM 13 2 1
Anoxybacillus flavithermus WK1
Geobacillus kaustophilus HTA426
Bacillus cereus ATCC 14579
Bacillus halodurans C-125
Bacillus clausii KSM-K16
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
manP
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -100
score = 7.66946
sequence = TATTACCGGAACCTATGGTAAAA

Gene: BSU12010: PTS system, mannose-specific IIB component (EC 2.7.1.69) / PTS system, mannose-specific IIC component (EC 2.7.1.69) / PTS system, mannose-specific IIA component (EC 2.7.1.69)
*
Bacillus amyloliquefaciens FZB42

Site:
position = -101
score = 7.66946
sequence = TATTTCCGGAACTTATGGTAAAA

Gene: RBAM_024200: PTS system, mannose-specific IIB component (EC 2.7.1.69) / PTS system, mannose-specific IIC component (EC 2.7.1.69) / PTS system, mannose-specific IIA component (EC 2.7.1.69)
 
Bacillus pumilus SAFR-032
*
Bacillus licheniformis DSM 13

Site:
position = -105
score = 7.32502
sequence = TTTTTCCGGAGCCTGCGGTAAAA

Gene: BLi02108: PTS system, mannose-specific IIB component (EC 2.7.1.69) / PTS system, mannose-specific IIC component (EC 2.7.1.69) / PTS system, mannose-specific IIA component (EC 2.7.1.69)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
PTS system, mannose-specific IIB component (EC 2.7.1.69) / PTS system, mannose-specific IIC component (EC 2.7.1.69) / PTS system, mannose-specific IIA component (EC 2.7.1.69)
manA
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU12020: Mannose-6-phosphate isomerase (EC 5.3.1.8)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_024190: Mannose-6-phosphate isomerase (EC 5.3.1.8)
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi02107: Mannose-6-phosphate isomerase (EC 5.3.1.8)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Mannose-6-phosphate isomerase (EC 5.3.1.8)
 
CRON 2.
manR
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -136
score = 6.6326
sequence = TTTTTCCGGAAGCTTCGGTAAAA

Gene: BSU12000: transcriptional antiterminator
*
Bacillus amyloliquefaciens FZB42

Site:
position = -139
score = 7.43983
sequence = TTTTTCCGGAACCTGCGGTAAAA

Gene: RBAM_024210: Transcription antiterminator, BglG family / PTS system, mannitol (Cryptic)-specific IIA component( EC:2.7.1.69 )
 
Bacillus pumilus SAFR-032
 
Bacillus licheniformis DSM 13

Gene: BLi02111: Activator of the mannose operon (transcriptional antiterminator), BglG family
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
transcriptional antiterminator
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD