Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog LicR - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: BglG
Regulation mode: activator
Biological process: Beta-glucosides utilization
Effector: HPr, phosphocarrier protein; LicB, lichenan-specific enzyme IIB PTS component
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 4 1
Bacillus amyloliquefaciens FZB42 4 1
Bacillus pumilus SAFR-032 4 1
Bacillus licheniformis DSM 13
Anoxybacillus flavithermus WK1
Geobacillus kaustophilus HTA426
Bacillus cereus ATCC 14579
Bacillus halodurans C-125
Bacillus clausii KSM-K16 5 1
Oceanobacillus iheyensis HTE831 5 1
Paenibacillus sp. JDR-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
licB
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -111
score = 5.48627
sequence = TTTTCCGTTGCCTGCGGAAAA

Gene: BSU38590: PTS system, beta-glucosides-specific IIB component (EC 2.7.1.69); PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
*
Bacillus amyloliquefaciens FZB42

Site:
position = -109
score = 6.17754
sequence = TTTTCCGTTAACAGCGGAAAA

Gene: RBAM_035790: PTS system, beta-glucosides-specific IIB component (EC 2.7.1.69); PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
*
Bacillus pumilus SAFR-032

Site:
position = -105
score = 5.67937
sequence = TTTCCGCTTCCTAAAGGAAAA

Gene: BPUM_3506: PTS system, beta-glucosides-specific IIB component (EC 2.7.1.69); PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
 
Bacillus licheniformis DSM 13

Gene: BLi04089: PTS system, beta-glucosides-specific IIB component (EC 2.7.1.69); PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
*
Bacillus clausii KSM-K16

Site:
position = -123
score = 5.43733
sequence = TTTTCCGTTTATATGGCTAAA

Gene: ABC0481: PTS system, beta-glucosides-specific IIB component (EC 2.7.1.69); PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
*
Oceanobacillus iheyensis HTE831

Site:
position = -97
score = 5.69611
sequence = TTTTCCGTTACACAGCGGAAA

Gene: OB2760: PTS system, beta-glucosides-specific IIB component (EC 2.7.1.69); PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
 
Paenibacillus sp. JDR-2
PTS system, beta-glucosides-specific IIB component (EC 2.7.1.69); PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
licC
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU38580: PTS system, beta-glucosides-specific IIC component (EC 2.7.1.69)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_035780: PTS system, beta-glucosides-specific IIC component (EC 2.7.1.69)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3505: PTS system, beta-glucosides-specific IIC component (EC 2.7.1.69)
 
Bacillus licheniformis DSM 13

Gene: BLi04088: PTS system, beta-glucosides-specific IIC component (EC 2.7.1.69)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC0482: PTS system, beta-glucosides-specific IIC component (EC 2.7.1.69)
 
Oceanobacillus iheyensis HTE831

Gene: OB2761: PTS system, beta-glucosides-specific IIC component (EC 2.7.1.69)
 
Paenibacillus sp. JDR-2
PTS system, beta-glucosides-specific IIC component (EC 2.7.1.69)
licA
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU38570: PTS system, beta-glucosides-specific IIA component (EC 2.7.1.69)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_035770: PTS system, beta-glucosides-specific IIA component (EC 2.7.1.69)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3504: PTS system, beta-glucosides-specific IIA component (EC 2.7.1.69)
 
Bacillus licheniformis DSM 13

Gene: BLi04087: PTS system, beta-glucosides-specific IIA component (EC 2.7.1.69)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC0483: PTS system, beta-glucosides-specific IIA component (EC 2.7.1.69)
 
Oceanobacillus iheyensis HTE831

Gene: OB2762: PTS system, beta-glucosides-specific IIA component (EC 2.7.1.69)
 
Paenibacillus sp. JDR-2
PTS system, beta-glucosides-specific IIA component (EC 2.7.1.69)
licH
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU38560: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_035760: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3503: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Bacillus licheniformis DSM 13

Gene: BLi04086: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC0484: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Oceanobacillus iheyensis HTE831

Gene: OB2763: 6-phospho-beta-glucosidase (EC 3.2.1.86)
 
Paenibacillus sp. JDR-2
6-phospho-beta-glucosidase (EC 3.2.1.86)
licR
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU38600: Transcriptional antiterminator of lichenan operon, BglG family
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_035800: Transcriptional antiterminator of lichenan operon, BglG family
 2
Bacillus pumilus SAFR-032

Gene: BPUM_3541: Transcriptional antiterminator of lichenan operon, BglG family

Gene: BPUM_3507: Transcriptional antiterminator of lichenan operon, BglG family
 
Bacillus licheniformis DSM 13

Gene: BLi04090: Transcriptional antiterminator of lichenan operon, BglG family
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC0806: Transcriptional antiterminator of lichenan operon, BglG family
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC0485: Transcriptional antiterminator of lichenan operon, BglG family
 
Oceanobacillus iheyensis HTE831

Gene: OB2764: Transcriptional antiterminator of lichenan operon, BglG family
 
Paenibacillus sp. JDR-2
Transcriptional antiterminator of lichenan operon, BglG family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD