Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GanR - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactan utilization
Effector: Beta-galactosides
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 6 2
Bacillus amyloliquefaciens FZB42
Bacillus pumilus SAFR-032 6 2
Bacillus licheniformis DSM 13 6 2
Anoxybacillus flavithermus WK1
Geobacillus kaustophilus HTA426
Bacillus cereus ATCC 14579
Bacillus halodurans C-125 5 1
Bacillus clausii KSM-K16 5 1
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
ganR
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -54
score = 6.56991
sequence = GAAAGTAAAATATTTTACTAAA

Gene: BSU34170: Transcriptional regulator of galactan utilization operon, LacI family
 
Bacillus amyloliquefaciens FZB42
*
Bacillus pumilus SAFR-032

Site:
position = -74
score = 5.55258
sequence = TTTAATAAAAATATTTACTAAT

Gene: BPUM_3612: Transcriptional regulator of galactan utilization operon, LacI family
*
Bacillus licheniformis DSM 13

Site:
position = -69
score = 7.00316
sequence = ATTAGTAAAATATTTTACTAAA

Gene: BLi04281: Transcriptional regulator of galactan utilization operon, LacI family
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH2018: Transcriptional regulator of galactan utilization operon, LacI family
 
Bacillus clausii KSM-K16

Gene: ABC3521: Transcriptional regulator of galactan utilization operon, LacI family
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Transcriptional regulator of galactan utilization operon, LacI family
 
CRON 2.
ganO
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -109
score = 5.91324
sequence = TTAGGTAAAAAAATTTACTCTA

Gene: BSU34160: Arabinogalactan oligomer ABC transporter, binding protein
 
Bacillus amyloliquefaciens FZB42
*
Bacillus pumilus SAFR-032

Site:
position = -126
score = 6.79557
sequence = TTGAGTAAAAAATTTTACTTAA

Gene: BPUM_3613: Arabinogalactan oligomer ABC transporter, binding protein
*
Bacillus licheniformis DSM 13

Site:
position = -110
score = 5.78815
sequence = TTTCGTAAAACATTTTACCTGT

Gene: BLi04280: Arabinogalactan oligomer ABC transporter, binding protein
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2191: Arabinogalactan oligomer ABC transporter, binding protein
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
*
Bacillus halodurans C-125

Site:
position = -127
score = 5.90124
sequence = TTTCCGAAAATATTTTACTCAT

Gene: BH2019: Arabinogalactan oligomer ABC transporter, binding protein
*
Bacillus clausii KSM-K16

Site:
position = -108
score = 7.16308
sequence = TTAAGTAAAATATTTTACTAAA

Gene: ABC3520: Arabinogalactan oligomer ABC transporter, binding protein
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Arabinogalactan oligomer ABC transporter, binding protein
ganP
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU34150: Arabinogalactan oligomer ABC transporter, membrane protein
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032

Gene: BPUM_3614: Arabinogalactan oligomer ABC transporter, membrane protein
 
Bacillus licheniformis DSM 13

Gene: BLi04279: Arabinogalactan oligomer ABC transporter, membrane protein
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2190: Arabinogalactan oligomer ABC transporter, membrane protein
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC4012: Arabinogalactan oligomer ABC transporter, membrane protein
 
Bacillus halodurans C-125

Gene: BH2020: Arabinogalactan oligomer ABC transporter, membrane protein
 
Bacillus clausii KSM-K16

Gene: ABC3519: Arabinogalactan oligomer ABC transporter, membrane protein
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Arabinogalactan oligomer ABC transporter, membrane protein
ganQ
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU34140: Arabinogalactan oligomer ABC transporter, membrane protein
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032

Gene: BPUM_3615: Arabinogalactan oligomer ABC transporter, membrane protein
 
Bacillus licheniformis DSM 13

Gene: BLi04278: Arabinogalactan oligomer ABC transporter, membrane protein
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2189: Arabinogalactan oligomer ABC transporter, membrane protein
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579

Gene: BC4011: Arabinogalactan oligomer ABC transporter, membrane protein
 
Bacillus halodurans C-125

Gene: BH2021: Arabinogalactan oligomer ABC transporter, membrane protein
 
Bacillus clausii KSM-K16

Gene: ABC3518: Arabinogalactan oligomer ABC transporter, membrane protein
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Arabinogalactan oligomer ABC transporter, membrane protein
ganB
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU34120: Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89)
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032

Gene: BPUM_3616: Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89)
 
Bacillus licheniformis DSM 13

Gene: BLi04276: Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH2023: Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89)
 
Bacillus clausii KSM-K16

Gene: ABC3517: Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Arabinogalactan endo-1,4-beta-galactosidase precursor (EC 3.2.1.89)
ganA
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU34130: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase)
 
Bacillus amyloliquefaciens FZB42
 
Bacillus pumilus SAFR-032

Gene: BPUM_3617: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase)
 2
Bacillus licheniformis DSM 13

Gene: BLi00447: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase)

Gene: BLi04277: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH2022: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase)
 
Bacillus clausii KSM-K16

Gene: ABC3516: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_1514: Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase)
Arabinogalactan type I oligomer exo-hydrolase (beta-galactosidase, lactase)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD