Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 26 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 5 2
Bacillus amyloliquefaciens FZB42 5 2
Bacillus pumilus SAFR-032 5 2
Bacillus licheniformis DSM 13 5 2
Anoxybacillus flavithermus WK1 5 2
Geobacillus kaustophilus HTA426 5 2
Bacillus cereus ATCC 14579 5 2
Bacillus halodurans C-125 6 3
Bacillus clausii KSM-K16 6 3
Oceanobacillus iheyensis HTE831 6 3
Paenibacillus sp. JDR-2 6 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
htpG
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU39820: Heat shock chaperone protein 90
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_036820: Heat shock chaperone protein 90
 
Bacillus pumilus SAFR-032

Gene: BPUM_0652: Heat shock chaperone protein 90
 
Bacillus licheniformis DSM 13

Gene: BLi04256: Heat shock chaperone protein 90
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
*
Bacillus halodurans C-125

Site:
position = -126
score = 7.12565
sequence = TTAGCACTCGTTGCTTGCAAGTGCTAA

Gene: BH1007: Heat shock chaperone protein 90
*
Bacillus clausii KSM-K16

Site:
position = -63
score = 7.52063
sequence = TTAGCACTCTAAACAAACGAGTGCTAA

Gene: ABC0970: Heat shock chaperone protein 90
*
Oceanobacillus iheyensis HTE831

Site:
position = -52
score = 7.61026
sequence = TTAGCACTCGTAAGTAGTGAGTGCTAA

Gene: OB3158: Heat shock chaperone protein 90
*
Paenibacillus sp. JDR-2

Site:
position = -64
score = 6.96768
sequence = TTAGCACTCCAACACGGAGAGTGCTAA

Gene: Pjdr2_5425: Heat shock chaperone protein 90
Heat shock chaperone protein 90
 
CRON 2.
hrcA
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -41
score = 7.49622
sequence = TTAGCACTCGCTTATTGAGAGTGCTAA

Gene: BSU25490: Heat-inducible transcription repressor HrcA
*
Bacillus amyloliquefaciens FZB42

Site:
position = -41
score = 7.27227
sequence = TTAGCACTCGCTGACCTTGAGTGCTAA

Gene: RBAM_023790: Heat-inducible transcription repressor HrcA
*
Bacillus pumilus SAFR-032

Site:
position = -41
score = 7.52135
sequence = TTAGCACTCGTTGAAAGAGAGTGCTAA

Gene: BPUM_2282: Heat-inducible transcription repressor HrcA
*
Bacillus licheniformis DSM 13

Site:
position = -41
score = 7.31968
sequence = TTAGCACTCAGTTGTGCCGAGTGCTAA

Gene: BLi02741: Heat-inducible transcription repressor HrcA
*
Anoxybacillus flavithermus WK1

Site:
position = -42
score = 7.37442
sequence = TTAGCACTCGCTTTGTTAGAGTGCTAA

Gene: Aflv_0833: Heat-inducible transcription repressor HrcA
*
Geobacillus kaustophilus HTA426

Site:
position = -41
score = 7.37013
sequence = TTAGCACTCGAATTGTTCGAGTGCTAA

Gene: GK2506: Heat-inducible transcription repressor HrcA
*
Bacillus cereus ATCC 14579

Site:
position = -43
score = 7.43613
sequence = TTAGCACTCAAAGACAAAGAGTGCTAA

Gene: BC4314: Heat-inducible transcription repressor HrcA
*
Bacillus halodurans C-125

Site:
position = -114
score = 7.32807
sequence = TTAGCACTCGAACTATGAGAGTGCTAA

Gene: BH1344: Heat-inducible transcription repressor HrcA
*
Bacillus clausii KSM-K16

Site:
position = -41
score = 7.50961
sequence = TTAGCACTCGTTGCATTTGAGTGCTAA

Gene: ABC1657: Heat-inducible transcription repressor HrcA
*
Oceanobacillus iheyensis HTE831

Site:
position = -41
score = 7.36628
sequence = TTAGCACTCAATAATCAAGAGTGCTAA

Gene: OB1970: Heat-inducible transcription repressor HrcA
*
Paenibacillus sp. JDR-2

Site:
position = -62
score = 7.22184
sequence = TTAGCACTCGGGCCTAATGAGTGCTAA

Gene: Pjdr2_2205: Heat-inducible transcription repressor HrcA
Heat-inducible transcription repressor HrcA
grpE
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU25480: Heat shock protein GrpE
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_023780: Heat shock protein GrpE
 
Bacillus pumilus SAFR-032

Gene: BPUM_2281: Heat shock protein GrpE
 
Bacillus licheniformis DSM 13

Gene: BLi02740: Heat shock protein GrpE
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0834: Heat shock protein GrpE
 
Geobacillus kaustophilus HTA426

Gene: GK2505: Heat shock protein GrpE
 
Bacillus cereus ATCC 14579

Gene: BC4313: Heat shock protein GrpE
 
Bacillus halodurans C-125

Gene: BH1345: Heat shock protein GrpE
 
Bacillus clausii KSM-K16

Gene: ABC1658: Heat shock protein GrpE
 
Oceanobacillus iheyensis HTE831

Gene: OB1969: Heat shock protein GrpE
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_2206: Heat shock protein GrpE
Heat shock protein GrpE
dnaK
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU25470: Chaperone protein DnaK
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_023770: Chaperone protein DnaK
 
Bacillus pumilus SAFR-032

Gene: BPUM_2280: Chaperone protein DnaK
 
Bacillus licheniformis DSM 13

Gene: BLi02739: Chaperone protein DnaK
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0835: Chaperone protein DnaK
 
Geobacillus kaustophilus HTA426

Gene: GK2504: Chaperone protein DnaK
 
Bacillus cereus ATCC 14579

Gene: BC4312: Chaperone protein DnaK
 
Bacillus halodurans C-125

Gene: BH1346: Chaperone protein DnaK
 
Bacillus clausii KSM-K16

Gene: ABC1659: Chaperone protein DnaK
 
Oceanobacillus iheyensis HTE831

Gene: OB1968: Chaperone protein DnaK
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_2207: Chaperone protein DnaK
Chaperone protein DnaK
 
CRON 3.
groES
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -62
score = 7.43196
sequence = TTAGCACTCTTTAGTGCTGAGTGCTAA

Gene: BSU06020: Co-chaperonin GroES (HSP10 family)
*
Bacillus amyloliquefaciens FZB42

Site:
position = -62
score = 7.39734
sequence = TTAGCACTCTTTAGAGCTGAGTGCTAA

Gene: RBAM_006470: Co-chaperonin GroES (HSP10 family)
*
Bacillus pumilus SAFR-032

Site:
position = -65
score = 7.51626
sequence = TTAGCACTCACTGGTGATGAGTGCTAA

Gene: BPUM_0534: Co-chaperonin GroES (HSP10 family)
*
Bacillus licheniformis DSM 13

Site:
position = -61
score = 7.33115
sequence = TTAGCACTCACCGAGTGCGAGTGCTAA

Gene: BLi00623: Co-chaperonin GroES (HSP10 family)
*
Anoxybacillus flavithermus WK1

Site:
position = -64
score = 7.45775
sequence = TTAGCACTCGACCGTAATGAGTGCTAA

Gene: Aflv_0211: Co-chaperonin GroES (HSP10 family)
*
Geobacillus kaustophilus HTA426

Site:
position = -69
score = 7.56189
sequence = TTAGCACTCAATAGTGATGAGTGCTAA

Gene: GK0248: Co-chaperonin GroES (HSP10 family)
*
Bacillus cereus ATCC 14579

Site:
position = -67
score = 7.17303
sequence = TTAGCACTCGGATGACTTGAGTGCTAA

Gene: BC0294: Co-chaperonin GroES (HSP10 family)
*
Bacillus halodurans C-125

Site:
position = -66
score = 7.54257
sequence = TTAGCACTCGTTTGAAGAGAGTGCTAA

Gene: BH0561: Co-chaperonin GroES (HSP10 family)
*
Bacillus clausii KSM-K16

Site:
position = -63
score = 7.34742
sequence = TTAGCACTCATCGAATCCGAGTGCTAA

Gene: ABC0881: Co-chaperonin GroES (HSP10 family)
*
Oceanobacillus iheyensis HTE831

Site:
position = -65
score = 7.4502
sequence = TTAGCACTCATCTATGAAGAGTGCTAA

Gene: OB0655: Co-chaperonin GroES (HSP10 family)
*
Paenibacillus sp. JDR-2

Site:
position = -70
score = 6.76064
sequence = TTAGCACTTCAAGCTTACGAGTGCTAA

Gene: Pjdr2_1050: Co-chaperonin GroES (HSP10 family)
Co-chaperonin GroES (HSP10 family)
groEL
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU06030: Chaperonin GroEL (HSP60 family)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_006480: Chaperonin GroEL (HSP60 family)
 
Bacillus pumilus SAFR-032

Gene: BPUM_0535: Chaperonin GroEL (HSP60 family)
 
Bacillus licheniformis DSM 13

Gene: BLi00624: Chaperonin GroEL (HSP60 family)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_0212: Chaperonin GroEL (HSP60 family)
 
Geobacillus kaustophilus HTA426

Gene: GK0249: Chaperonin GroEL (HSP60 family)
 
Bacillus cereus ATCC 14579

Gene: BC0295: Chaperonin GroEL (HSP60 family)
 
Bacillus halodurans C-125

Gene: BH0562: Chaperonin GroEL (HSP60 family)
 
Bacillus clausii KSM-K16

Gene: ABC0882: Chaperonin GroEL (HSP60 family)
 
Oceanobacillus iheyensis HTE831

Gene: OB0656: Chaperonin GroEL (HSP60 family)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_1051: Chaperonin GroEL (HSP60 family)
Chaperonin GroEL (HSP60 family)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD