Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GlvR2 - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: RpiR
Regulation mode:
Biological process: Maltose utilization
Effector: Maltose-6-phosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 5 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168
Bacillus amyloliquefaciens FZB42
Bacillus pumilus SAFR-032 3 2
Bacillus licheniformis DSM 13
Anoxybacillus flavithermus WK1
Geobacillus kaustophilus HTA426
Bacillus cereus ATCC 14579
Bacillus halodurans C-125
Bacillus clausii KSM-K16 3 2
Oceanobacillus iheyensis HTE831
Paenibacillus sp. JDR-2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
glvR2
 
Bacillus subtilis subsp. subtilis str. 168
 
Bacillus amyloliquefaciens FZB42
*
Bacillus pumilus SAFR-032

Site:
position = -51
score = 5.39044
sequence = AGATTATATTTTCACAGAAAGAAAA

Gene: BPUM_0659: Transcriptional regulator of maltose utilization, RpiR family
 
Bacillus licheniformis DSM 13
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
*
Bacillus clausii KSM-K16

Site:
position = -28
score = 4.86684
sequence = GGAAAATATTTTCATAGAAGGTGAG

Site:
position = -47
score = 5.16148
sequence = AGATTATATTTTCACAGAAGGAAAA

Gene: ABC3579: Transcriptional regulator of maltose utilization, RpiR family
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Transcriptional regulator of maltose utilization, RpiR family
 
CRON 2.
glvC
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU08200: PTS system, maltose-specific IIC component (EC 2.7.1.69) / PTS system, maltose-specific IIB component (EC 2.7.1.69)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_008380: PTS system, maltose-specific IIC component (EC 2.7.1.69) / PTS system, maltose-specific IIB component (EC 2.7.1.69)
*
Bacillus pumilus SAFR-032

Site:
position = -130
score = 7.07423
sequence = TGAAAATATTTTCTTTCTGTGAAAA

Gene: BPUM_0660: PTS system, maltose-specific IIC component (EC 2.7.1.69) / PTS system, maltose-specific IIB component (EC 2.7.1.69)
 
Bacillus licheniformis DSM 13

Gene: BLi00857: PTS system, maltose-specific IIC component (EC 2.7.1.69) / PTS system, maltose-specific IIB component (EC 2.7.1.69)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
*
Bacillus clausii KSM-K16

Site:
position = -130
score = 6.84528
sequence = TGAAAATATTTTCCTTCTGTGAAAA

Gene: ABC3580: PTS system, maltose-specific IIC component (EC 2.7.1.69) / PTS system, maltose-specific IIB component (EC 2.7.1.69)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
PTS system, maltose-specific IIC component (EC 2.7.1.69) / PTS system, maltose-specific IIB component (EC 2.7.1.69)
glvA
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU08180: Maltose-6'-phosphate glucosidase (EC 3.2.1.122)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_008360: Maltose-6'-phosphate glucosidase (EC 3.2.1.122)
 
Bacillus pumilus SAFR-032

Gene: BPUM_0661: Maltose-6'-phosphate glucosidase (EC 3.2.1.122)
 
Bacillus licheniformis DSM 13

Gene: BLi00855: Maltose-6'-phosphate glucosidase (EC 3.2.1.122)
 
Anoxybacillus flavithermus WK1
 
Geobacillus kaustophilus HTA426
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125
 
Bacillus clausii KSM-K16

Gene: ABC3581: Maltose-6'-phosphate glucosidase (EC 3.2.1.122)
 
Oceanobacillus iheyensis HTE831
 
Paenibacillus sp. JDR-2
Maltose-6'-phosphate glucosidase (EC 3.2.1.122)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD