Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CggR - Bacillales

Properties
Regulator type: Transcription factor
Regulator family: SorC
Regulation mode: repressor
Biological process: Glycolysis
Effector: Fructose-1,6-diphosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacillus subtilis subsp. subtilis str. 168 6 1
Bacillus amyloliquefaciens FZB42 6 1
Bacillus pumilus SAFR-032 6 1
Bacillus licheniformis DSM 13 6 1
Anoxybacillus flavithermus WK1 6 1
Geobacillus kaustophilus HTA426 6 1
Bacillus cereus ATCC 14579 2 1
Bacillus halodurans C-125 6 1
Bacillus clausii KSM-K16 6 1
Oceanobacillus iheyensis HTE831 6 1
Paenibacillus sp. JDR-2 6 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
cggR
*
Bacillus subtilis subsp. subtilis str. 168

Site:
position = -64
score = 8.75806
sequence = CGGGACGTTTTTTGTCATAGCGGGACATATAATGTCC

Gene: BSU33950: Transcriptional regulator of central glycolytic gene, SorC family
*
Bacillus amyloliquefaciens FZB42

Site:
position = -65
score = 8.57389
sequence = TGGGACGTTTTTTGTCATAGCGGGACATTTTCTGTCC

Gene: RBAM_031310: Transcriptional regulator of central glycolytic gene, SorC family
*
Bacillus pumilus SAFR-032

Site:
position = -63
score = 8.18254
sequence = CGGGACGTTTTTTGTCACAGTGGGACTTTTTTAGTCC

Gene: BPUM_3058: Transcriptional regulator of central glycolytic gene, SorC family
*
Bacillus licheniformis DSM 13

Site:
position = -64
score = 8.28119
sequence = TGGGACGTTTTCAGTCACTGCGGGACATTATTCGTCC

Gene: BLi03666: Transcriptional regulator of central glycolytic gene, SorC family
*
Anoxybacillus flavithermus WK1

Site:
position = -75
score = 8.52871
sequence = TGGGACATAATAAGTCATAGCGGGACTTAAAACGTCC

Gene: Aflv_2519: Transcriptional regulator of central glycolytic gene, SorC family
*
Geobacillus kaustophilus HTA426

Site:
position = -84
score = 6.44502
sequence = AGGAATTTTTTATGGCACTGCGGGACATAATATGTCA

Site:
position = -64
score = 8.60918
sequence = CGGGACATAATATGTCATACCGGGACATAAAATGTCC

Gene: GK3059: Transcriptional regulator of central glycolytic gene, SorC family
*
Bacillus cereus ATCC 14579

Site:
position = -61
score = 8.14935
sequence = TGGGACACAAAATGTCACTACGGGACGTAAAGTGACC

Gene: BC5141: Transcriptional regulator of central glycolytic gene, SorC family
*
Bacillus halodurans C-125

Site:
position = -77
score = 6.61624
sequence = CGGGACGTAAAATGTCTATGAGGGTCAAAAAACGTCC

Gene: BH3561: Transcriptional regulator of central glycolytic gene, SorC family
*
Bacillus clausii KSM-K16

Site:
position = -59
score = 7.12406
sequence = CGGGACATAATATGTCTGCGAGGGACGTTATATGTCC

Gene: ABC3022: Transcriptional regulator of central glycolytic gene, SorC family
*
Oceanobacillus iheyensis HTE831

Site:
position = -58
score = 6.16296
sequence = CGGGACATAATGTAACCATACGGGACGTATTTAGACC

Gene: OB2439: Transcriptional regulator of central glycolytic gene, SorC family
*
Paenibacillus sp. JDR-2

Site:
position = -88
score = 6.17044
sequence = TGGGACTTAAAGTGAGTATGCGGGACGTTTAACGTCC

Gene: Pjdr2_0176: Transcriptional regulator of central glycolytic gene, SorC family
Transcriptional regulator of central glycolytic gene, SorC family
gapA
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU33940: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_031300: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3057: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Bacillus licheniformis DSM 13

Gene: BLi03665: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2518: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Geobacillus kaustophilus HTA426

Gene: GK3058: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Bacillus cereus ATCC 14579

Gene: BC5140: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Bacillus halodurans C-125

Gene: BH3560: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Bacillus clausii KSM-K16

Gene: ABC3021: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Oceanobacillus iheyensis HTE831

Gene: OB2438: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0177: NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
NAD-dependent glyceraldehyde-3-phosphate dehydrogenase (EC 1.2.1.12)
pgk
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU33930: Phosphoglycerate kinase (EC 2.7.2.3)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_031290: Phosphoglycerate kinase (EC 2.7.2.3)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3056: Phosphoglycerate kinase (EC 2.7.2.3)
 
Bacillus licheniformis DSM 13

Gene: BLi03664: Phosphoglycerate kinase (EC 2.7.2.3)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2517: Phosphoglycerate kinase (EC 2.7.2.3)
 
Geobacillus kaustophilus HTA426

Gene: GK3057: Phosphoglycerate kinase (EC 2.7.2.3)
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH3559: Phosphoglycerate kinase (EC 2.7.2.3)
 
Bacillus clausii KSM-K16

Gene: ABC3020: Phosphoglycerate kinase (EC 2.7.2.3)
 
Oceanobacillus iheyensis HTE831

Gene: OB2437: Phosphoglycerate kinase (EC 2.7.2.3)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0178: Phosphoglycerate kinase (EC 2.7.2.3)
Phosphoglycerate kinase (EC 2.7.2.3)
tpiA
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU33920: Triosephosphate isomerase (EC 5.3.1.1)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_031280: Triosephosphate isomerase (EC 5.3.1.1)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3055: Triosephosphate isomerase (EC 5.3.1.1)
 
Bacillus licheniformis DSM 13

Gene: BLi03663: Triosephosphate isomerase (EC 5.3.1.1)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2516: Triosephosphate isomerase (EC 5.3.1.1)
 
Geobacillus kaustophilus HTA426

Gene: GK3056: Triosephosphate isomerase (EC 5.3.1.1)
 
Bacillus cereus ATCC 14579
 
Bacillus halodurans C-125

Gene: BH3558: Triosephosphate isomerase (EC 5.3.1.1)
 
Bacillus clausii KSM-K16

Gene: ABC3019: Triosephosphate isomerase (EC 5.3.1.1)
 
Oceanobacillus iheyensis HTE831

Gene: OB2436: Triosephosphate isomerase (EC 5.3.1.1)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0179: Triosephosphate isomerase (EC 5.3.1.1)
Triosephosphate isomerase (EC 5.3.1.1)
pgm
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU33910: 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_031270: 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3054: 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1)
 
Bacillus licheniformis DSM 13

Gene: BLi03662: 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2515: 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1)
 
Geobacillus kaustophilus HTA426

Gene: GK3055: 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1)
 
Bacillus cereus ATCC 14579

Gene: BC5136: 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1)
 
Bacillus halodurans C-125

Gene: BH3557: 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1)
 
Bacillus clausii KSM-K16

Gene: ABC3018: 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1)
 
Oceanobacillus iheyensis HTE831

Gene: OB2435: 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0180: 2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1)
2,3-bisphosphoglycerate-independent phosphoglycerate mutase (EC 5.4.2.1)
eno
 
Bacillus subtilis subsp. subtilis str. 168

Gene: BSU33900: Enolase (EC 4.2.1.11)
 
Bacillus amyloliquefaciens FZB42

Gene: RBAM_031260: Enolase (EC 4.2.1.11)
 
Bacillus pumilus SAFR-032

Gene: BPUM_3053: Enolase (EC 4.2.1.11)
 
Bacillus licheniformis DSM 13

Gene: BLi03661: Enolase (EC 4.2.1.11)
 
Anoxybacillus flavithermus WK1

Gene: Aflv_2514: Enolase (EC 4.2.1.11)
 
Geobacillus kaustophilus HTA426

Gene: GK3054: Enolase (EC 4.2.1.11)
 
Bacillus cereus ATCC 14579

Gene: BC5135: Enolase (EC 4.2.1.11)
 
Bacillus halodurans C-125

Gene: BH3556: Enolase (EC 4.2.1.11)
 
Bacillus clausii KSM-K16

Gene: ABC3017: Enolase (EC 4.2.1.11)
 
Oceanobacillus iheyensis HTE831

Gene: OB2434: Enolase (EC 4.2.1.11)
 
Paenibacillus sp. JDR-2

Gene: Pjdr2_0181: Enolase (EC 4.2.1.11)
Enolase (EC 4.2.1.11)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD