Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog XylR - Thermotogales

Properties
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Xylose utilization
Effector: Xylose; Glucose
Phylum: Thermotogae
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 39 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Thermotoga maritima MSB8 27 7
Thermotoga sp. RQ2 27 8
Thermotoga neapolitana DSM 4359 26 8
Thermotoga petrophila RKU-1 27 7
Thermotoga naphthophila RKU-10 27 7
Thermotoga lettingae TMO 12 2
Thermosipho africanus TCF52B
Thermosipho melanesiensis BI429
Fervidobacterium nodosum Rt17-B1
Petrotoga mobilis SJ95
Thermotogales bacterium TBF 19.5.1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
xtpN
*
Thermotoga maritima MSB8

Site:
position = -45
score = 5.38094
sequence = GAAATTTCTTTAGAGGAAAAAAT

Gene: TM0309: Predicted xylose oligosaccharide ABC transporter, substrate-binding component
*
Thermotoga sp. RQ2

Site:
position = -51
score = 5.38094
sequence = GAAATTTCTTTAGAGGAAAAAAT

Gene: TRQ2_0622: Predicted xylose oligosaccharide ABC transporter, substrate-binding component
*2
Thermotoga neapolitana DSM 4359

Gene: CTN_0378: Predicted xylose oligosaccharide ABC transporter, substrate-binding component

Site:
position = -65
score = 4.28744
sequence = AaaATTgtTTGgtAgaAAAaAAg

Gene: CTN_0379: Predicted xylose oligosaccharide ABC transporter, substrate-binding component
*
Thermotoga petrophila RKU-1

Site:
position = -51
score = 4.92245
sequence = GAAAGTTCTTTAGAGGAAAAAAT

Gene: Tpet_0608: Predicted xylose oligosaccharide ABC transporter, substrate-binding component
*
Thermotoga naphthophila RKU-10

Site:
position = -13
score = 4.93795
sequence = gaaATTTCTTtAgtgaAAAaAAT

Gene: Tnap_0948: Predicted xylose oligosaccharide ABC transporter, substrate-binding component
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Predicted xylose oligosaccharide ABC transporter, substrate-binding component
bgaL
 
Thermotoga maritima MSB8

Gene: TM0310: Beta-galactosidase (EC 3.2.1.23)
 
Thermotoga sp. RQ2

Gene: TRQ2_0621: Beta-galactosidase (EC 3.2.1.23)
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0377: Beta-galactosidase (EC 3.2.1.23)
 
Thermotoga petrophila RKU-1

Gene: Tpet_0607: Beta-galactosidase (EC 3.2.1.23)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0949: Beta-galactosidase (EC 3.2.1.23)
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Beta-galactosidase (EC 3.2.1.23)
 
CRON 2.
xloE
*
Thermotoga maritima MSB8

Site:
position = -53
score = 5.82684
sequence = AATATTTCCCGAAAGGAAAAAAT

Gene: TM0071: Xylose oligosaccharides ABC transporter, sugar-binding protein
*
Thermotoga sp. RQ2

Site:
position = -53
score = 5.82684
sequence = AATATTTCCCGAAAGGAAAAAAT

Gene: TRQ2_0876: Xylose oligosaccharides ABC transporter, sugar-binding protein
*
Thermotoga neapolitana DSM 4359

Site:
position = -52
score = 5.82684
sequence = AATATTTCCCGAAAGGAAAAAAT

Gene: CTN_0622: Xylose oligosaccharides ABC transporter, sugar-binding protein
*
Thermotoga petrophila RKU-1

Site:
position = -54
score = 5.37705
sequence = AATATTTCCCGAAAGGAAAAAAA

Gene: Tpet_0853: Xylose oligosaccharides ABC transporter, sugar-binding protein
*
Thermotoga naphthophila RKU-10

Site:
position = -53
score = 5.82684
sequence = AATATTTCCCGAAAGGAAAAAAT

Gene: Tnap_0701: Xylose oligosaccharides ABC transporter, sugar-binding protein
*
Thermotoga lettingae TMO

Site:
position = -52
score = 5.24436
sequence = AATTTTTCGAGGAAATAAATAAT

Gene: Tlet_0350: Xylose oligosaccharides ABC transporter, sugar-binding protein
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Xylose oligosaccharides ABC transporter, sugar-binding protein
xloF
 
Thermotoga maritima MSB8

Gene: TM0072: Xylose oligosaccharides ABC transporter, permease protein 1
 
Thermotoga sp. RQ2

Gene: TRQ2_0875: Xylose oligosaccharides ABC transporter, permease protein 1
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0621: Xylose oligosaccharides ABC transporter, permease protein 1
 
Thermotoga petrophila RKU-1

Gene: Tpet_0852: Xylose oligosaccharides ABC transporter, permease protein 1
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0702: Xylose oligosaccharides ABC transporter, permease protein 1
 
Thermotoga lettingae TMO

Gene: Tlet_0351: Xylose oligosaccharides ABC transporter, permease protein 1
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Xylose oligosaccharides ABC transporter, permease protein 1
xloG
 
Thermotoga maritima MSB8

Gene: TM0073: Xylose oligosaccharides ABC transporter, permease protein 2
 
Thermotoga sp. RQ2

Gene: TRQ2_0874: Xylose oligosaccharides ABC transporter, permease protein 2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0620: Xylose oligosaccharides ABC transporter, permease protein 2
 
Thermotoga petrophila RKU-1

Gene: Tpet_0851: Xylose oligosaccharides ABC transporter, permease protein 2
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0703: Xylose oligosaccharides ABC transporter, permease protein 2
 
Thermotoga lettingae TMO

Gene: Tlet_0352: Xylose oligosaccharides ABC transporter, permease protein 2
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Xylose oligosaccharides ABC transporter, permease protein 2
xloK
 
Thermotoga maritima MSB8

Gene: TM0074: Xylose oligosaccharides ABC transporter, ATP-binding protein 1
 
Thermotoga sp. RQ2

Gene: TRQ2_0873: Xylose oligosaccharides ABC transporter, ATP-binding protein 1
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0619: Xylose oligosaccharides ABC transporter, ATP-binding protein 1
 
Thermotoga petrophila RKU-1

Gene: Tpet_0850: Xylose oligosaccharides ABC transporter, ATP-binding protein 1
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0704: Xylose oligosaccharides ABC transporter, ATP-binding protein 1
 
Thermotoga lettingae TMO

Gene: Tlet_0353: Xylose oligosaccharides ABC transporter, ATP-binding protein 1
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Xylose oligosaccharides ABC transporter, ATP-binding protein 1
xloL
 
Thermotoga maritima MSB8

Gene: TM0075: Xylose oligosaccharides ABC transporter, ATP-binding protein 2
 
Thermotoga sp. RQ2

Gene: TRQ2_0872: Xylose oligosaccharides ABC transporter, ATP-binding protein 2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0618: Xylose oligosaccharides ABC transporter, ATP-binding protein 2
 
Thermotoga petrophila RKU-1

Gene: Tpet_0849: Xylose oligosaccharides ABC transporter, ATP-binding protein 2
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0705: Xylose oligosaccharides ABC transporter, ATP-binding protein 2
 
Thermotoga lettingae TMO

Gene: Tlet_0354: Xylose oligosaccharides ABC transporter, ATP-binding protein 2
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Xylose oligosaccharides ABC transporter, ATP-binding protein 2
xyl3
 
Thermotoga maritima MSB8

Gene: TM0076: Beta-xylosidase (EC 3.2.1.37)
 
Thermotoga sp. RQ2

Gene: TRQ2_0871: Beta-xylosidase (EC 3.2.1.37)
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0616: Beta-xylosidase (EC 3.2.1.37)
 
Thermotoga petrophila RKU-1

Gene: Tpet_0848: Beta-xylosidase (EC 3.2.1.37)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0706: Beta-xylosidase (EC 3.2.1.37)
 
Thermotoga lettingae TMO

Gene: Tlet_0355: Beta-xylosidase (EC 3.2.1.37)
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95

Gene: Pmob_0229: Beta-xylosidase (EC 3.2.1.37)
 
Thermotogales bacterium TBF 19.5.1
Beta-xylosidase (EC 3.2.1.37)
axeA
 
Thermotoga maritima MSB8

Gene: TM0077: Acetyl xylan esterase (EC 3.1.1.41)
 
Thermotoga sp. RQ2

Gene: TRQ2_0870: Acetyl xylan esterase (EC 3.1.1.41)
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0615: Acetyl xylan esterase (EC 3.1.1.41)
 
Thermotoga petrophila RKU-1

Gene: Tpet_0847: Acetyl xylan esterase (EC 3.1.1.41)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0707: Acetyl xylan esterase (EC 3.1.1.41)
 
Thermotoga lettingae TMO

Gene: Tlet_0356: Acetyl xylan esterase (EC 3.1.1.41)
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Acetyl xylan esterase (EC 3.1.1.41)
xylR
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO

Gene: Tlet_0357: Xylose-responsive transcription regulator, ROK family
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Xylose-responsive transcription regulator, ROK family
CTN_0617
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0617: Endo-1,3-beta-xylanase
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Endo-1,3-beta-xylanase
 
CRON 3.
xynB
*
Thermotoga maritima MSB8

Site:
position = -189
score = 5.82684
sequence = ATTTTTTCCTTTCGGGAAATATT

Gene: TM0070: Endo-1,4-beta-xylanase B ( EC 3.2.1.8 )
*
Thermotoga sp. RQ2

Site:
position = -189
score = 5.82684
sequence = ATTTTTTCCTTTCGGGAAATATT

Gene: TRQ2_0877: Endo-1,4-beta-xylanase B ( EC 3.2.1.8 )
*
Thermotoga neapolitana DSM 4359

Site:
position = -190
score = 5.82684
sequence = ATTTTTTCCTTTCGGGAAATATT

Gene: CTN_0623: Endo-1,4-beta-xylanase B ( EC 3.2.1.8 )
*
Thermotoga petrophila RKU-1

Site:
position = -189
score = 5.37705
sequence = TTTTTTTCCTTTCGGGAAATATT

Gene: Tpet_0854: Endo-1,4-beta-xylanase B ( EC 3.2.1.8 )
*
Thermotoga naphthophila RKU-10

Site:
position = -189
score = 5.82684
sequence = ATTTTTTCCTTTCGGGAAATATT

Gene: Tnap_0700: Endo-1,4-beta-xylanase B ( EC 3.2.1.8 )
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Endo-1,4-beta-xylanase B ( EC 3.2.1.8 )
 
CRON 4.
xynA3
 
Thermotoga maritima MSB8
*
Thermotoga sp. RQ2

Site:
position = -40
score = 5.24781
sequence = GTTTTTTCCTTTCTGAAAATAAC

Gene: TRQ2_1549: Endo-1,4-beta-xylanase C precursor (EC 3.2.1.8)
*
Thermotoga neapolitana DSM 4359

Site:
position = -41
score = 5.24781
sequence = GTTTTTTCCTTTCTGAAAATAAC

Gene: CTN_1302: Endo-1,4-beta-xylanase C precursor (EC 3.2.1.8)
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Endo-1,4-beta-xylanase C precursor (EC 3.2.1.8)
 
CRON 5.
xylA
*
Thermotoga maritima MSB8

Site:
position = -38
score = 4.98147
sequence = ATAATTGATTGATAGAAAAAATT

Gene: TM1667: Xylose isomerase (EC 5.3.1.5)
*
Thermotoga sp. RQ2

Site:
position = -38
score = 4.98147
sequence = ATAATTGATTGATAGAAAAAATT

Gene: TRQ2_1162: Xylose isomerase (EC 5.3.1.5)
*
Thermotoga neapolitana DSM 4359

Site:
position = -38
score = 4.98147
sequence = ATAATTGATTGATAGAAAAAATT

Gene: CTN_0720: Xylose isomerase (EC 5.3.1.5)
*
Thermotoga petrophila RKU-1

Site:
position = -38
score = 4.98147
sequence = ATAATTGATTGATAGAAAAAATT

Gene: Tpet_1124: Xylose isomerase (EC 5.3.1.5)
*
Thermotoga naphthophila RKU-10

Site:
position = -38
score = 4.98147
sequence = ATAATTGATTGATAGAAAAAATT

Gene: Tnap_1139: Xylose isomerase (EC 5.3.1.5)
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95

Gene: Pmob_0226: Xylose isomerase (EC 5.3.1.5)
 
Thermotogales bacterium TBF 19.5.1
Xylose isomerase (EC 5.3.1.5)
TM1668
 
Thermotoga maritima MSB8

Gene: TM1668: conserved hypothetical protein
 
Thermotoga sp. RQ2

Gene: TRQ2_1161: conserved hypothetical protein
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0719: conserved hypothetical protein
 
Thermotoga petrophila RKU-1

Gene: Tpet_1123: conserved hypothetical protein
 
Thermotoga naphthophila RKU-10

Gene: Tnap_1138: conserved hypothetical protein
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95

Gene: Pmob_0461: conserved hypothetical protein
 
Thermotogales bacterium TBF 19.5.1
conserved hypothetical protein
 
CRON 6.
xylR
*
Thermotoga maritima MSB8

Site:
position = -61
score = 5.43417
sequence = ATTATTTCCTGCATATAATTAAT

Gene: TM0110: Xylose-responsive transcription regulator, ROK family
*
Thermotoga sp. RQ2

Site:
position = -61
score = 5.22702
sequence = ATTATTTCCCGCATATAATTAAT

Gene: TRQ2_0837: Xylose-responsive transcription regulator, ROK family
*
Thermotoga neapolitana DSM 4359

Site:
position = -34
score = 5.149
sequence = ATTAATTCCTGCATATAATTAAT

Gene: CTN_0581: Xylose-responsive transcription regulator, ROK family
*
Thermotoga petrophila RKU-1

Site:
position = -61
score = 5.22702
sequence = ATTATTTCCCGCATATAATTAAT

Gene: Tpet_0814: Xylose-responsive transcription regulator, ROK family
*
Thermotoga naphthophila RKU-10

Site:
position = -61
score = 5.22702
sequence = ATTATTTCCCGCATATAATTAAT

Gene: Tnap_0740: Xylose-responsive transcription regulator, ROK family
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Xylose-responsive transcription regulator, ROK family
adhB
 
Thermotoga maritima MSB8

Gene: TM0111: Iron-containing alcohol dehydrogenase
 
Thermotoga sp. RQ2

Gene: TRQ2_0836: Iron-containing alcohol dehydrogenase
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0580: Iron-containing alcohol dehydrogenase
 
Thermotoga petrophila RKU-1

Gene: Tpet_0813: Iron-containing alcohol dehydrogenase
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0741: Iron-containing alcohol dehydrogenase
 
Thermotoga lettingae TMO

Gene: Tlet_0180: Iron-containing alcohol dehydrogenase
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Iron-containing alcohol dehydrogenase
xylF
 
Thermotoga maritima MSB8

Gene: TM0112: Xylose ABC transporter, permease component
 
Thermotoga sp. RQ2

Gene: TRQ2_0835: Xylose ABC transporter, permease component
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0578: Xylose ABC transporter, permease component
 
Thermotoga petrophila RKU-1

Gene: Tpet_0812: Xylose ABC transporter, permease component
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0742: Xylose ABC transporter, permease component
*
Thermotoga lettingae TMO

Site:
position = -183
score = 5.22669
sequence = AATTTTTCGGGGAAAGAAATAAT

Gene: Tlet_0358: Xylose ABC transporter, permease component
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Xylose ABC transporter, permease component
xylU
 
Thermotoga maritima MSB8

Gene: TM0113: Acetyl xylan esterase XylU (EC 3.1.1.41)
 
Thermotoga sp. RQ2

Gene: TRQ2_0834: Acetyl xylan esterase XylU (EC 3.1.1.41)
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0577: Acetyl xylan esterase XylU (EC 3.1.1.41)
 
Thermotoga petrophila RKU-1

Gene: Tpet_0811: Acetyl xylan esterase XylU (EC 3.1.1.41)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0743: Acetyl xylan esterase XylU (EC 3.1.1.41)
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Acetyl xylan esterase XylU (EC 3.1.1.41)
xylE
 
Thermotoga maritima MSB8

Gene: TM0114: Xylose ABC transporter, substrate-binding component
 
Thermotoga sp. RQ2

Gene: TRQ2_0833: Xylose ABC transporter, substrate-binding component
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0576: Xylose ABC transporter, substrate-binding component
 
Thermotoga petrophila RKU-1

Gene: Tpet_0810: Xylose ABC transporter, substrate-binding component
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0744: Xylose ABC transporter, substrate-binding component
 
Thermotoga lettingae TMO

Gene: Tlet_0359: Xylose ABC transporter, substrate-binding component
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Xylose ABC transporter, substrate-binding component
xylK
 
Thermotoga maritima MSB8

Gene: TM0115: Xylose ABC transporter, ATP-binding component
 
Thermotoga sp. RQ2

Gene: TRQ2_0832: Xylose ABC transporter, ATP-binding component
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0575: Xylose ABC transporter, ATP-binding component
 
Thermotoga petrophila RKU-1

Gene: Tpet_0809: Xylose ABC transporter, ATP-binding component
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0745: Xylose ABC transporter, ATP-binding component
 
Thermotoga lettingae TMO

Gene: Tlet_0360: Xylose ABC transporter, ATP-binding component
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Xylose ABC transporter, ATP-binding component
xylB
 
Thermotoga maritima MSB8

Gene: TM0116: Xylulose kinase (EC 2.7.1.17)
 
Thermotoga sp. RQ2

Gene: TRQ2_0831: Xylulose kinase (EC 2.7.1.17)
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0574: Xylulose kinase (EC 2.7.1.17)
 
Thermotoga petrophila RKU-1

Gene: Tpet_0808: Xylulose kinase (EC 2.7.1.17)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0746: Xylulose kinase (EC 2.7.1.17)
 
Thermotoga lettingae TMO

Gene: Tlet_0361: Xylulose kinase (EC 2.7.1.17)
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Xylulose kinase (EC 2.7.1.17)
 
CRON 7.
CTN_0633
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2
*
Thermotoga neapolitana DSM 4359

Site:
position = -245
score = 5.28183
sequence = GTTATTTCTTACGGAGAAAAAAT

Gene: CTN_0633: Transposase, IS605 OrfB family
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Transposase, IS605 OrfB family
xtpF
*
Thermotoga maritima MSB8

Site:
position = -254
score = 5.76129
sequence = GTTATTTTTTGTAAAGAAAAAAT

Gene: TM0060: Xylan oligosaccharide ABC transporter, permease component 1
*
Thermotoga sp. RQ2

Site:
position = -254
score = 5.76129
sequence = GTTATTTTTTGTAAAGAAAAAAT

Gene: TRQ2_0886: Xylan oligosaccharide ABC transporter, permease component 1
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0634: Xylan oligosaccharide ABC transporter, permease component 1
*
Thermotoga petrophila RKU-1

Site:
position = -255
score = 5.76129
sequence = GTTATTTTTTGTAAAGAAAAAAT

Gene: Tpet_0864: Xylan oligosaccharide ABC transporter, permease component 1
*
Thermotoga naphthophila RKU-10

Site:
position = -253
score = 5.76129
sequence = GTTATTTTTTGTAAAGAAAAAAT

Gene: Tnap_0690: Xylan oligosaccharide ABC transporter, permease component 1
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Xylan oligosaccharide ABC transporter, permease component 1
xtpG
 
Thermotoga maritima MSB8

Gene: TM0059: Xylan oligosaccharide ABC transporter, permease component 2
 
Thermotoga sp. RQ2

Gene: TRQ2_0887: Xylan oligosaccharide ABC transporter, permease component 2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0635: Xylan oligosaccharide ABC transporter, permease component 2
 
Thermotoga petrophila RKU-1

Gene: Tpet_0865: Xylan oligosaccharide ABC transporter, permease component 2
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0689: Xylan oligosaccharide ABC transporter, permease component 2
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Xylan oligosaccharide ABC transporter, permease component 2
xtpK
 
Thermotoga maritima MSB8

Gene: TM0058: Xylan oligosaccharide ABC transporter, ATP-binding protein 1
 
Thermotoga sp. RQ2

Gene: TRQ2_0888: Xylan oligosaccharide ABC transporter, ATP-binding protein 1
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0636: Xylan oligosaccharide ABC transporter, ATP-binding protein 1
 
Thermotoga petrophila RKU-1

Gene: Tpet_0866: Xylan oligosaccharide ABC transporter, ATP-binding protein 1
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0688: Xylan oligosaccharide ABC transporter, ATP-binding protein 1
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Xylan oligosaccharide ABC transporter, ATP-binding protein 1
xtpL
 
Thermotoga maritima MSB8

Gene: TM0057: Xylan oligosaccharide ABC transporter, ATP-binding protein 2
 
Thermotoga sp. RQ2

Gene: TRQ2_0889: Xylan oligosaccharide ABC transporter, ATP-binding protein 2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0637: Xylan oligosaccharide ABC transporter, ATP-binding protein 2
 
Thermotoga petrophila RKU-1

Gene: Tpet_0867: Xylan oligosaccharide ABC transporter, ATP-binding protein 2
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0687: Xylan oligosaccharide ABC transporter, ATP-binding protein 2
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Xylan oligosaccharide ABC transporter, ATP-binding protein 2
xtpE
 
Thermotoga maritima MSB8

Gene: TM0056: Xylan oligosaccharide ABC transporter, substrate-binding component
 
Thermotoga sp. RQ2

Gene: TRQ2_0890: Xylan oligosaccharide ABC transporter, substrate-binding component
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0638: Xylan oligosaccharide ABC transporter, substrate-binding component
 
Thermotoga petrophila RKU-1

Gene: Tpet_0868: Xylan oligosaccharide ABC transporter, substrate-binding component
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0686: Xylan oligosaccharide ABC transporter, substrate-binding component
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Xylan oligosaccharide ABC transporter, substrate-binding component
aguA
 
Thermotoga maritima MSB8

Gene: TM0055: Alpha-glucuronidase (EC 3.2.1.139)
 
Thermotoga sp. RQ2

Gene: TRQ2_0891: Alpha-glucuronidase (EC 3.2.1.139)
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0639: Alpha-glucuronidase (EC 3.2.1.139)
 
Thermotoga petrophila RKU-1

Gene: Tpet_0869: Alpha-glucuronidase (EC 3.2.1.139)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0685: Alpha-glucuronidase (EC 3.2.1.139)
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Alpha-glucuronidase (EC 3.2.1.139)
 
CRON 8.
xynA1
*
Thermotoga maritima MSB8

Site:
position = -87
score = 5.76129
sequence = ATTTTTTCTTTACAAAAAATAAC

Gene: TM0061: Endo-1,4-beta-xylanase A precursor (EC 3.2.1.8)
*
Thermotoga sp. RQ2

Site:
position = -87
score = 5.76129
sequence = ATTTTTTCTTTACAAAAAATAAC

Gene: TRQ2_0885: Endo-1,4-beta-xylanase A precursor (EC 3.2.1.8)
*
Thermotoga neapolitana DSM 4359

Site:
position = -41
score = 5.28183
sequence = ATTTTTTCTCCGTAAGAAATAAC

Gene: CTN_0632: Endo-1,4-beta-xylanase A precursor (EC 3.2.1.8)
*
Thermotoga petrophila RKU-1

Site:
position = -87
score = 5.76129
sequence = ATTTTTTCTTTACAAAAAATAAC

Gene: Tpet_0863: Endo-1,4-beta-xylanase A precursor (EC 3.2.1.8)
*
Thermotoga naphthophila RKU-10

Site:
position = -87
score = 5.76129
sequence = ATTTTTTCTTTACAAAAAATAAC

Gene: Tnap_0691: Endo-1,4-beta-xylanase A precursor (EC 3.2.1.8)
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95

Gene: Pmob_0231: Endo-1,4-beta-xylanase A precursor (EC 3.2.1.8)
 
Thermotogales bacterium TBF 19.5.1
Endo-1,4-beta-xylanase A precursor (EC 3.2.1.8)
cenC
 
Thermotoga maritima MSB8

Gene: TM0062: Carbohydrate-binding, CenC domain protein
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1

Gene: Tpet_0862: Carbohydrate-binding, CenC domain protein
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0692: Carbohydrate-binding, CenC domain protein
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Carbohydrate-binding, CenC domain protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD