Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog TreR - Thermotogales

Properties
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Trehalose utilization
Effector: Trehalose
Phylum: Thermotogae
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Thermotoga maritima MSB8 2 1
Thermotoga sp. RQ2 5 2
Thermotoga neapolitana DSM 4359 6 2
Thermotoga petrophila RKU-1 6 2
Thermotoga naphthophila RKU-10 6 2
Thermotoga lettingae TMO 5 1
Thermosipho africanus TCF52B 5 2
Thermosipho melanesiensis BI429 5 2
Fervidobacterium nodosum Rt17-B1 5 2
Petrotoga mobilis SJ95
Thermotogales bacterium TBF 19.5.1 5 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
amyE
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2
*
Thermotoga neapolitana DSM 4359

Site:
position = -478
score = 5.89165
sequence = tTaTtTTCATTTAACGAAaAAAa

Gene: CTN_0781: extracellular alpha-amylase precursor
*
Thermotoga petrophila RKU-1

Site:
position = -143
score = 5.89165
sequence = TTATTTTCATTTAACGAAAAAAA

Gene: Tpet_0953: extracellular alpha-amylase precursor
*
Thermotoga naphthophila RKU-10

Site:
position = -143
score = 5.89165
sequence = TTATTTTCATTTAACGAAAAAAA

Gene: Tnap_0601: extracellular alpha-amylase precursor
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1

Gene: Fnod_1683: extracellular alpha-amylase precursor
 
Petrotoga mobilis SJ95

Gene: Pmob_1428: extracellular alpha-amylase precursor
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_0461: extracellular alpha-amylase precursor
extracellular alpha-amylase precursor
treE
 
Thermotoga maritima MSB8
*
Thermotoga sp. RQ2

Site:
position = -139
score = 5.89165
sequence = TTATTTTCATTTAACGAAAAAAA

Gene: TRQ2_0970: Trehalose ABC transporter, substrate-binding component
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0780: Trehalose ABC transporter, substrate-binding component
 
Thermotoga petrophila RKU-1

Gene: Tpet_0954: Trehalose ABC transporter, substrate-binding component
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0600: Trehalose ABC transporter, substrate-binding component
 
Thermotoga lettingae TMO
*
Thermosipho africanus TCF52B

Site:
position = -327
score = 5.93507
sequence = TTTAATTCGAATTTCGAAAAAAT

Site:
position = -56
score = 5.89233
sequence = ATAAATTCGAAAATCGAAAAAAT

Gene: THA_844: Trehalose ABC transporter, substrate-binding component
*
Thermosipho melanesiensis BI429

Site:
position = -316
score = 5.59713
sequence = ATTTTTTTGAATTTCGAAATAAT

Gene: Tmel_1820: Trehalose ABC transporter, substrate-binding component
*
Fervidobacterium nodosum Rt17-B1

Site:
position = -248
score = 5.9263
sequence = ATATATTCGAATTTCGAATATAT

Gene: Fnod_0450: Trehalose ABC transporter, substrate-binding component
 
Petrotoga mobilis SJ95

Gene: Pmob_0027: Trehalose ABC transporter, substrate-binding component
 
Thermotogales bacterium TBF 19.5.1
Trehalose ABC transporter, substrate-binding component
treF
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2

Gene: TRQ2_0971: Trehalose ABC transporter, permease component 1
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0779: Trehalose ABC transporter, permease component 1
 
Thermotoga petrophila RKU-1

Gene: Tpet_0955: Trehalose ABC transporter, permease component 1
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0599: Trehalose ABC transporter, permease component 1
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B

Gene: THA_845: Trehalose ABC transporter, permease component 1
 
Thermosipho melanesiensis BI429

Gene: Tmel_1819: Trehalose ABC transporter, permease component 1
 
Fervidobacterium nodosum Rt17-B1

Gene: Fnod_0449: Trehalose ABC transporter, permease component 1
 
Petrotoga mobilis SJ95

Gene: Pmob_0028: Trehalose ABC transporter, permease component 1
 
Thermotogales bacterium TBF 19.5.1
Trehalose ABC transporter, permease component 1
treG
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2

Gene: TRQ2_0972: Trehalose ABC transporter, permease component 2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0778: Trehalose ABC transporter, permease component 2
 
Thermotoga petrophila RKU-1

Gene: Tpet_0956: Trehalose ABC transporter, permease component 2
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0598: Trehalose ABC transporter, permease component 2
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B

Gene: THA_846: Trehalose ABC transporter, permease component 2
 
Thermosipho melanesiensis BI429

Gene: Tmel_1818: Trehalose ABC transporter, permease component 2
 
Fervidobacterium nodosum Rt17-B1

Gene: Fnod_0448: Trehalose ABC transporter, permease component 2
 
Petrotoga mobilis SJ95

Gene: Pmob_0029: Trehalose ABC transporter, permease component 2
 
Thermotogales bacterium TBF 19.5.1
Trehalose ABC transporter, permease component 2
 
CRON 2.
treX
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10
*
Thermotoga lettingae TMO

Site:
position = -8
score = 5.70249
sequence = ATTAATTCATGTTACGACAAAAT

Gene: Tlet_1844: Predicted trehalose ABC transporter, substrate-binding component (Archaea-type)
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
*
Thermotogales bacterium TBF 19.5.1

Site:
position = -74
score = 5.62443
sequence = CTTTATTCAAGACTTGAATTTAT

Gene: Kole_0303: Predicted trehalose ABC transporter, substrate-binding component (Archaea-type)
Predicted trehalose ABC transporter, substrate-binding component (Archaea-type)
treY
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO

Gene: Tlet_1843: Predicted trehalose ABC transporter, permease component 1 (Archaea-type)
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_0302: Predicted trehalose ABC transporter, permease component 1 (Archaea-type)
Predicted trehalose ABC transporter, permease component 1 (Archaea-type)
treZ
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO

Gene: Tlet_1842: Predicted trehalose ABC transporter, permease component 2 (Archaea-type)
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_0301: Predicted trehalose ABC transporter, permease component 2 (Archaea-type)
Predicted trehalose ABC transporter, permease component 2 (Archaea-type)
treT
*
Thermotoga maritima MSB8

Site:
position = -38
score = 6.09365
sequence = ATTAATTCAAGTTACGAATAAAT

Gene: TM0392: Trehalose synthase, nucleoside diphosphate glucose dependent
*
Thermotoga sp. RQ2

Site:
position = -38
score = 6.09365
sequence = ATTAATTCAAGTTACGAATAAAT

Gene: TRQ2_0542: Trehalose synthase, nucleoside diphosphate glucose dependent
*
Thermotoga neapolitana DSM 4359

Site:
position = -37
score = 6.09365
sequence = ATTAATTCAAGTTACGAATAAAT

Gene: CTN_0277: Trehalose synthase, nucleoside diphosphate glucose dependent
*
Thermotoga petrophila RKU-1

Site:
position = -38
score = 6.09365
sequence = ATTAATTCAAGTTACGAATAAAT

Gene: Tpet_0528: Trehalose synthase, nucleoside diphosphate glucose dependent
*
Thermotoga naphthophila RKU-10

Site:
position = -38
score = 6.09365
sequence = ATTAATTCAAGTTACGAATAAAT

Gene: Tnap_0184: Trehalose synthase, nucleoside diphosphate glucose dependent
 
Thermotoga lettingae TMO

Gene: Tlet_1841: Trehalose synthase, nucleoside diphosphate glucose dependent
*
Thermosipho africanus TCF52B

Site:
position = -35
score = 5.93507
sequence = ATTTTTTCGAAATTCGAATTAAA

Gene: THA_843: Trehalose synthase, nucleoside diphosphate glucose dependent
*
Thermosipho melanesiensis BI429

Site:
position = -38
score = 5.59713
sequence = ATTATTTCGAAATTCAAAAAAAT

Gene: Tmel_1821: Trehalose synthase, nucleoside diphosphate glucose dependent
*
Fervidobacterium nodosum Rt17-B1

Site:
position = -127
score = 5.9263
sequence = ATATATTCGAAATTCGAATATAT

Gene: Fnod_0451: Trehalose synthase, nucleoside diphosphate glucose dependent
 
Petrotoga mobilis SJ95
*
Thermotogales bacterium TBF 19.5.1

Site:
position = -75
score = 5.64614
sequence = ATTTATTCAATACATGAACAAAG

Gene: Kole_0299: Trehalose synthase, nucleoside diphosphate glucose dependent
Trehalose synthase, nucleoside diphosphate glucose dependent
treR
 
Thermotoga maritima MSB8

Gene: TM0393: Regulator of trehalose utilization TreR, ROK family
 
Thermotoga sp. RQ2

Gene: TRQ2_0541: Regulator of trehalose utilization TreR, ROK family
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0276: Regulator of trehalose utilization TreR, ROK family
 
Thermotoga petrophila RKU-1

Gene: Tpet_0527: Regulator of trehalose utilization TreR, ROK family
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0185: Regulator of trehalose utilization TreR, ROK family
 
Thermotoga lettingae TMO

Gene: Tlet_1840: Regulator of trehalose utilization TreR, ROK family
 
Thermosipho africanus TCF52B

Gene: THA_842: Regulator of trehalose utilization TreR, ROK family
 
Thermosipho melanesiensis BI429

Gene: Tmel_1822: Regulator of trehalose utilization TreR, ROK family
 
Fervidobacterium nodosum Rt17-B1

Gene: Fnod_0452: Regulator of trehalose utilization TreR, ROK family
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_0300: Regulator of trehalose utilization TreR, ROK family
Regulator of trehalose utilization TreR, ROK family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD