Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RbsR - Thermotogales

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Thermotogae
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 15 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Thermotoga maritima MSB8 12 1
Thermotoga sp. RQ2
Thermotoga neapolitana DSM 4359 12 1
Thermotoga petrophila RKU-1 6 1
Thermotoga naphthophila RKU-10 6 1
Thermotoga lettingae TMO 9 1
Thermosipho africanus TCF52B 6 1
Thermosipho melanesiensis BI429
Fervidobacterium nodosum Rt17-B1
Petrotoga mobilis SJ95 6 1
Thermotogales bacterium TBF 19.5.1 6 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rbsK
*
Thermotoga maritima MSB8

Site:
position = -34
score = 5.88371
sequence = TTTCGAAAACGATTTCATCA

Site:
position = -46
score = 6.50488
sequence = TTGTGAAAACGATTTCGAAA

Gene: TM0960: Ribokinase (EC 2.7.1.15)
 
Thermotoga sp. RQ2
*
Thermotoga neapolitana DSM 4359

Site:
position = 32
score = 6.50488
sequence = TTGTGAAAACGATTTCGAAA

Site:
position = 44
score = 5.88371
sequence = TTTCGAAAACGATTTCATCA

Gene: CTN_1616: Ribokinase (EC 2.7.1.15)
*
Thermotoga petrophila RKU-1

Site:
position = -56
score = 6.50488
sequence = TTGTGAAAACGATTTCGAAA

Site:
position = -44
score = 6.56563
sequence = TTTCGAAAACGTTTTCAAAG

Gene: Tpet_1789: Ribokinase (EC 2.7.1.15)
*
Thermotoga naphthophila RKU-10

Site:
position = -56
score = 6.50488
sequence = TTGTGAAAACGATTTCGAAA

Site:
position = -44
score = 6.56563
sequence = TTTCGAAAACGTTTTCAAAG

Gene: Tnap_1790: Ribokinase (EC 2.7.1.15)
 
Thermotoga lettingae TMO

Gene: Tlet_1905: Ribokinase (EC 2.7.1.15)
 
Thermosipho africanus TCF52B

Gene: THA_674: Ribokinase (EC 2.7.1.15)
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95

Gene: Pmob_0924: Ribokinase (EC 2.7.1.15)
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_0601: Ribokinase (EC 2.7.1.15)
Ribokinase (EC 2.7.1.15)
rbsD
 
Thermotoga maritima MSB8

Gene: TM0959: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_1617: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Thermotoga petrophila RKU-1

Gene: Tpet_1791: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_1792: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Thermotoga lettingae TMO
*
Thermosipho africanus TCF52B

Site:
position = -30
score = 5.86333
sequence = TTTCGAAAACGTTTTCTAGG

Site:
position = -42
score = 6.02071
sequence = ATACGAAAACGTTTTCGAAA

Gene: THA_669: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95

Gene: Pmob_0920: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_0600: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsB
 
Thermotoga maritima MSB8

Gene: TM0958: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_1618: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Thermotoga petrophila RKU-1

Gene: Tpet_1794: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_1795: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Thermotoga lettingae TMO

Gene: Tlet_1325: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Thermosipho africanus TCF52B

Gene: THA_672: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95

Gene: Pmob_0923: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_0602: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
TM0957
 
Thermotoga maritima MSB8

Gene: TM0957: hypothetical protein
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_1619: hypothetical protein
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO

Gene: Tlet_1326: hypothetical protein
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
hypothetical protein
rbsA
 
Thermotoga maritima MSB8

Gene: TM0956: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_1620: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Thermotoga petrophila RKU-1

Gene: Tpet_1792: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_1793: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Thermotoga lettingae TMO

Gene: Tlet_1327: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Thermosipho africanus TCF52B

Gene: THA_670: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95

Gene: Pmob_0921: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_0604: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC
 
Thermotoga maritima MSB8

Gene: TM0955: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_1621: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Thermotoga petrophila RKU-1

Gene: Tpet_1793: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_1794: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Thermotoga lettingae TMO

Gene: Tlet_1328: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Thermosipho africanus TCF52B

Gene: THA_671: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95

Gene: Pmob_0922: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_0603: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
tktA
 
Thermotoga maritima MSB8

Gene: TM0954: transketolase, N-terminal subunit
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_1622: transketolase, N-terminal subunit
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO

Gene: Tlet_1329: transketolase, N-terminal subunit
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
transketolase, N-terminal subunit
tktB
 
Thermotoga maritima MSB8

Gene: TM0953: transketolase, C-terminal subunit
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_1623: transketolase, C-terminal subunit
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO

Gene: Tlet_1330: transketolase, C-terminal subunit
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
transketolase, C-terminal subunit
drlK
 
Thermotoga maritima MSB8

Gene: TM0952: Predicted D-ribulose kinase, FGGY family
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_1624: Predicted D-ribulose kinase, FGGY family
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO

Gene: Tlet_1331: Predicted D-ribulose kinase, FGGY family
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Predicted D-ribulose kinase, FGGY family
darA
 
Thermotoga maritima MSB8

Gene: TM0951: Predicted D-arabinose isomerase
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_1625: Predicted D-arabinose isomerase
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO

Gene: Tlet_1332: Predicted D-arabinose isomerase
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Predicted D-arabinose isomerase
TM0950
 
Thermotoga maritima MSB8

Gene: TM0950: hypothetical protein
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_1626: hypothetical protein
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
hypothetical protein
rbsR
 
Thermotoga maritima MSB8

Gene: TM0949: Predicted regulator of ribose utilization, LacI family
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_1627: Predicted regulator of ribose utilization, LacI family
 
Thermotoga petrophila RKU-1

Gene: Tpet_1790: Predicted regulator of ribose utilization, LacI family
 
Thermotoga naphthophila RKU-10

Gene: Tnap_1791: Predicted regulator of ribose utilization, LacI family
*
Thermotoga lettingae TMO

Site:
position = -47
score = 5.77485
sequence = TTTCAAGAACGTTTTCAAAA

Site:
position = -59
score = 6.5232
sequence = TCTTGAAAACGTTTTCAAGA

Gene: Tlet_1324: Predicted regulator of ribose utilization, LacI family
 
Thermosipho africanus TCF52B

Gene: THA_673: Predicted regulator of ribose utilization, LacI family
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
*
Petrotoga mobilis SJ95

Site:
position = -43
score = 6.02508
sequence = TTCCGAAAACGTTTGCATAA

Gene: Pmob_0919: Predicted regulator of ribose utilization, LacI family
*
Thermotogales bacterium TBF 19.5.1

Site:
position = -39
score = 5.04608
sequence = TCATGTAAACGTTTACGTAA

Site:
position = -27
score = 5.59306
sequence = TTACGTAAACGTTTTCAGGA

Gene: Kole_0605: Predicted regulator of ribose utilization, LacI family
Predicted regulator of ribose utilization, LacI family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD