Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IolR - Thermotogales

Properties
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Inositol utilization
Effector:
Phylum: Thermotogae
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Thermotoga maritima MSB8 6 1
Thermotoga sp. RQ2
Thermotoga neapolitana DSM 4359 6 1
Thermotoga petrophila RKU-1 6 1
Thermotoga naphthophila RKU-10 6 1
Thermotoga lettingae TMO
Thermosipho africanus TCF52B
Thermosipho melanesiensis BI429
Fervidobacterium nodosum Rt17-B1
Petrotoga mobilis SJ95
Thermotogales bacterium TBF 19.5.1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
iolR
*
Thermotoga maritima MSB8

Site:
position = -39
score = 6.01228
sequence = GTTGGTTAGTTAACGATAACAAA

Gene: TM0411: Regulator of myo-inositol utilization InoR, ROK family
 
Thermotoga sp. RQ2
*
Thermotoga neapolitana DSM 4359

Site:
position = -40
score = 6.25205
sequence = GTTGGTTAGTAAATGAAAACAAA

Gene: CTN_0258: Regulator of myo-inositol utilization InoR, ROK family
*
Thermotoga petrophila RKU-1

Site:
position = -40
score = 6.25205
sequence = GTTGGTTAGTAAATGAAAACAAA

Gene: Tpet_0509: Regulator of myo-inositol utilization InoR, ROK family
*
Thermotoga naphthophila RKU-10

Site:
position = -40
score = 6.25205
sequence = GTTGGTTAGTAAATGAAAACAAA

Gene: Tnap_0203: Regulator of myo-inositol utilization InoR, ROK family
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Regulator of myo-inositol utilization InoR, ROK family
iolM
 
Thermotoga maritima MSB8

Gene: TM0412: Inosose dehydrogenase
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0257: Inosose dehydrogenase
 
Thermotoga petrophila RKU-1

Gene: Tpet_0508: Inosose dehydrogenase
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0204: Inosose dehydrogenase
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Inosose dehydrogenase
iolN
 
Thermotoga maritima MSB8

Gene: TM0413: Keto-inosose hydrolase
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0256: Keto-inosose hydrolase
 
Thermotoga petrophila RKU-1

Gene: Tpet_0507: Keto-inosose hydrolase
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0205: Keto-inosose hydrolase
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Keto-inosose hydrolase
iolG
 
Thermotoga maritima MSB8

Gene: TM0414: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0255: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
 
Thermotoga petrophila RKU-1

Gene: Tpet_0506: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0206: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
iolK
 
Thermotoga maritima MSB8

Gene: TM0415: Novel inositol-related kinase, PfkB family (EC 2.7.1.12)
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0254: Novel inositol-related kinase, PfkB family (EC 2.7.1.12)
 
Thermotoga petrophila RKU-1

Gene: Tpet_0505: Novel inositol-related kinase, PfkB family (EC 2.7.1.12)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0207: Novel inositol-related kinase, PfkB family (EC 2.7.1.12)
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Novel inositol-related kinase, PfkB family (EC 2.7.1.12)
iolO
 
Thermotoga maritima MSB8

Gene: TM0416: 5-keto-L-gluconate epimerase
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0253: 5-keto-L-gluconate epimerase
 
Thermotoga petrophila RKU-1

Gene: Tpet_0504: 5-keto-L-gluconate epimerase
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0208: 5-keto-L-gluconate epimerase
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
5-keto-L-gluconate epimerase
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD