Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HrcA - Thermotogales

Properties
Regulator type: Transcription factor
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Phylum: Thermotogae
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 50 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Thermotoga maritima MSB8 9 4
Thermotoga sp. RQ2 8 4
Thermotoga neapolitana DSM 4359 11 5
Thermotoga petrophila RKU-1 10 5
Thermotoga naphthophila RKU-10 10 5
Thermotoga lettingae TMO 8 3
Thermosipho africanus TCF52B 8 4
Thermosipho melanesiensis BI429 8 4
Fervidobacterium nodosum Rt17-B1 10 6
Petrotoga mobilis SJ95 8 4
Thermotogales bacterium TBF 19.5.1 8 3
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
groS
*
Thermotoga maritima MSB8

Site:
position = -48
score = 6.61133
sequence = TTAGCAGTCGAATGATGAGAGTGCTAA

Gene: TM0505: GroES chaperonin
*
Thermotoga sp. RQ2

Site:
position = -48
score = 6.43529
sequence = TTAGCAGTCGAACGATGAGAGTGCTAA

Gene: TRQ2_0431: GroES chaperonin
*2
Thermotoga neapolitana DSM 4359

Site:
position = -52
score = 6.24123
sequence = TTAGCAGTCATGAGTCGAGAGTGCTAA

Gene: CTN_0166: GroES chaperonin

Gene: CTN_0165: GroES chaperonin
*
Thermotoga petrophila RKU-1

Site:
position = -48
score = 6.43529
sequence = TTAGCAGTCGAACGATGAGAGTGCTAA

Gene: Tpet_0416: GroES chaperonin
*
Thermotoga naphthophila RKU-10

Site:
position = -48
score = 6.08443
sequence = TTAGCAGTCAGACGATGAGAGTGCTAA

Gene: Tnap_0286: GroES chaperonin
*
Thermotoga lettingae TMO

Site:
position = -57
score = 6.50601
sequence = TTAGCACTCAAACAGTTCGAGTGATAA

Gene: Tlet_0318: GroES chaperonin
*
Thermosipho africanus TCF52B

Site:
position = -53
score = 5.86469
sequence = TTAGCAGTCAATGAATTAGAGTGACAA

Gene: THA_270: GroES chaperonin
*
Thermosipho melanesiensis BI429

Site:
position = -54
score = 5.82558
sequence = TTAGCAGTCGATGATTAAGAGTGACAA

Gene: Tmel_0053: GroES chaperonin
*
Fervidobacterium nodosum Rt17-B1

Site:
position = -61
score = 5.80433
sequence = TTAACAAACGGAATATTAGAGTGATAA

Gene: Fnod_1544: GroES chaperonin
*
Petrotoga mobilis SJ95

Site:
position = -85
score = 6.85445
sequence = TTAGCACTCTTAATATTTGATTGCTAA

Gene: Pmob_1157: GroES chaperonin
*
Thermotogales bacterium TBF 19.5.1

Site:
position = -71
score = 6.2951
sequence = TTAGCAGACTCATATAAAGAGTGCTAA

Gene: Kole_1626: GroES chaperonin
GroES chaperonin
groL
 
Thermotoga maritima MSB8

Gene: TM0506: GroEL chaperonin
 
Thermotoga sp. RQ2

Gene: TRQ2_0430: GroEL chaperonin
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0164: GroEL chaperonin
 
Thermotoga petrophila RKU-1

Gene: Tpet_0415: GroEL chaperonin
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0287: GroEL chaperonin
 
Thermotoga lettingae TMO

Gene: Tlet_0317: GroEL chaperonin
 
Thermosipho africanus TCF52B

Gene: THA_269: GroEL chaperonin
 
Thermosipho melanesiensis BI429

Gene: Tmel_0052: GroEL chaperonin
 
Fervidobacterium nodosum Rt17-B1

Gene: Fnod_1543: GroEL chaperonin
 
Petrotoga mobilis SJ95

Gene: Pmob_1158: GroEL chaperonin
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_1627: GroEL chaperonin
GroEL chaperonin
 
CRON 2.
hrcA
*
Thermotoga maritima MSB8

Site:
position = -30
score = 6.54111
sequence = TTAGCACTCAAAAGAAGGGAGTGCTAA

Gene: TM0851: Heat shock response regulator, HrcA family
*
Thermotoga sp. RQ2

Site:
position = -30
score = 6.54111
sequence = TTAGCACTCAAAAGAAGGGAGTGCTAA

Gene: TRQ2_0076: Heat shock response regulator, HrcA family
*
Thermotoga neapolitana DSM 4359

Site:
position = -28
score = 6.64654
sequence = TTAGCACTCAAAAGAAAGGAGTGCTAA

Gene: CTN_1724: Heat shock response regulator, HrcA family
*
Thermotoga petrophila RKU-1

Site:
position = -30
score = 6.54111
sequence = TTAGCACTCAAAAGAAGGGAGTGCTAA

Gene: Tpet_0076: Heat shock response regulator, HrcA family
*
Thermotoga naphthophila RKU-10

Site:
position = -30
score = 6.54111
sequence = TTAGCACTCAAAAGAAGGGAGTGCTAA

Gene: Tnap_0076: Heat shock response regulator, HrcA family
*
Thermotoga lettingae TMO

Site:
position = -29
score = 6.751
sequence = TTAGCACTCAAATGATGAGAGTGATAA

Gene: Tlet_1782: Heat shock response regulator, HrcA family
*
Thermosipho africanus TCF52B

Site:
position = -28
score = 5.83476
sequence = TTATCAGACAAGGATAAAGAGTGATAA

Gene: THA_306: Heat shock response regulator, HrcA family
*
Thermosipho melanesiensis BI429

Site:
position = -51
score = 6.12726
sequence = TTATCAGACATAGCATAAGAGTGATAA

Gene: Tmel_0089: Heat shock response regulator, HrcA family
*
Fervidobacterium nodosum Rt17-B1

Site:
position = -103
score = 5.1343
sequence = TTGGCAGATGGATAATAAGTTTGCTAA

Gene: Fnod_1242: Heat shock response regulator, HrcA family
*
Petrotoga mobilis SJ95

Site:
position = -28
score = 5.79694
sequence = TTAGCACTTAATATGCGGGAGTGATAA

Gene: Pmob_1823: Heat shock response regulator, HrcA family
*
Thermotogales bacterium TBF 19.5.1

Site:
position = -28
score = 5.60512
sequence = TTAGCAGTCTCCAGGGAGGAGTGCTAA

Gene: Kole_1384: Heat shock response regulator, HrcA family
Heat shock response regulator, HrcA family
grpE
 
Thermotoga maritima MSB8

Gene: TM0850: Heat shock protein
 
Thermotoga sp. RQ2

Gene: TRQ2_0077: Heat shock protein
 
Thermotoga neapolitana DSM 4359

Gene: CTN_1725: Heat shock protein
 
Thermotoga petrophila RKU-1

Gene: Tpet_0077: Heat shock protein
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0077: Heat shock protein
 
Thermotoga lettingae TMO

Gene: Tlet_1781: Heat shock protein
 
Thermosipho africanus TCF52B

Gene: THA_305: Heat shock protein
 
Thermosipho melanesiensis BI429

Gene: Tmel_0088: Heat shock protein
 
Fervidobacterium nodosum Rt17-B1

Gene: Fnod_1243: Heat shock protein
 
Petrotoga mobilis SJ95

Gene: Pmob_1824: Heat shock protein
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_1385: Heat shock protein
Heat shock protein
dnaJ
 
Thermotoga maritima MSB8

Gene: TM0849: Chaperone Hsp40
 
Thermotoga sp. RQ2

Gene: TRQ2_0078: Chaperone Hsp40
 
Thermotoga neapolitana DSM 4359

Gene: CTN_1726: Chaperone Hsp40
 
Thermotoga petrophila RKU-1

Gene: Tpet_0078: Chaperone Hsp40
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0078: Chaperone Hsp40
 
Thermotoga lettingae TMO

Gene: Tlet_1780: Chaperone Hsp40
 
Thermosipho africanus TCF52B

Gene: THA_304: Chaperone Hsp40
 
Thermosipho melanesiensis BI429

Gene: Tmel_0087: Chaperone Hsp40
 
Fervidobacterium nodosum Rt17-B1

Gene: Fnod_1244: Chaperone Hsp40
 
Petrotoga mobilis SJ95

Gene: Pmob_1825: Chaperone Hsp40
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_1386: Chaperone Hsp40
Chaperone Hsp40
 
CRON 3.
recF
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
*
Fervidobacterium nodosum Rt17-B1

Site:
position = -93
score = 5.75024
sequence = TTATCACTCCATCTTGTCAAGTGATAA

Gene: Fnod_1362: DNA replication and repair protein RecF
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
DNA replication and repair protein RecF
rgyR
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1

Gene: Fnod_1363: Reverse gyrase
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Reverse gyrase
 
CRON 4.
TM0370
*
Thermotoga maritima MSB8

Site:
position = -16
score = 5.90504
sequence = TTATCAAAAGAAAAAAATGATTGCTAA

Gene: TM0370: Predicted RecA-like ATPase, COG0467
 
Thermotoga sp. RQ2

Gene: TRQ2_0561: Predicted RecA-like ATPase, COG0467
*
Thermotoga neapolitana DSM 4359

Site:
position = -20
score = 6.35876
sequence = TTATCAATCGATATTGATGAGTGCTAA

Gene: CTN_0301: Predicted RecA-like ATPase, COG0467
*
Thermotoga petrophila RKU-1

Site:
position = -49
score = 6.3797
sequence = TTATCAAACGAAAAAAATGATTGCTAA

Gene: Tpet_0547: Predicted RecA-like ATPase, COG0467
*
Thermotoga naphthophila RKU-10

Site:
position = -49
score = 6.3797
sequence = TTATCAAACGAAAAAAATGATTGCTAA

Gene: Tnap_0165: Predicted RecA-like ATPase, COG0467
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B

Gene: THA_115: Predicted RecA-like ATPase, COG0467
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Predicted RecA-like ATPase, COG0467
TM0369
 
Thermotoga maritima MSB8

Gene: TM0369: Conserved hypothetical protein
 
Thermotoga sp. RQ2

Gene: TRQ2_0562: Conserved hypothetical protein
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0300: Conserved hypothetical protein
 
Thermotoga petrophila RKU-1

Gene: Tpet_0548: Conserved hypothetical protein
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0164: Conserved hypothetical protein
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B

Gene: THA_116: Conserved hypothetical protein
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Conserved hypothetical protein
 
CRON 5.
clpA
 
Thermotoga maritima MSB8
*
Thermotoga sp. RQ2

Site:
position = -51
score = 6.34661
sequence = TTATCAAACGTAAGATTTAAGTGCTAA

Gene: TRQ2_0054: Chaperone protein
*
Thermotoga neapolitana DSM 4359

Site:
position = -42
score = 6.25257
sequence = TTATCATTCTTAATAATTAAGTGCTAA

Gene: CTN_1702: Chaperone protein
*
Thermotoga petrophila RKU-1

Site:
position = -51
score = 6.59266
sequence = TTATCAAACGTAATATTTGAGTGCTAA

Gene: Tpet_0054: Chaperone protein
*
Thermotoga naphthophila RKU-10

Site:
position = -51
score = 6.59266
sequence = TTATCAAACGTAATATTTGAGTGCTAA

Gene: Tnap_0054: Chaperone protein
 
Thermotoga lettingae TMO
*
Thermosipho africanus TCF52B

Site:
position = -54
score = 6.55914
sequence = TTATCAGTCTAAATATATGACTGATAA

Gene: THA_711: Chaperone protein
*
Thermosipho melanesiensis BI429

Site:
position = -55
score = 6.31991
sequence = TTATCAGTCTATATATGTGACTGATAA

Gene: Tmel_0413: Chaperone protein
 
Fervidobacterium nodosum Rt17-B1
*
Petrotoga mobilis SJ95

Site:
position = -68
score = 6.26411
sequence = TTAGCAAATAAAAGTAACGAGTGATAA

Gene: Pmob_1629: Chaperone protein
 
Thermotogales bacterium TBF 19.5.1
Chaperone protein
 
CRON 6.
dnaK
*
Thermotoga maritima MSB8

Site:
position = -179
score = 5.69509
sequence = TTATCATTCAAACATTTCATTTGCTAT

Gene: TM0373: Chaperone Hsp70
*
Thermotoga sp. RQ2

Site:
position = -179
score = 5.94261
sequence = TTATCATTCAAAAGTTTCATTTGCTAT

Gene: TRQ2_0558: Chaperone Hsp70
*
Thermotoga neapolitana DSM 4359

Site:
position = -174
score = 6.16296
sequence = TTATCATTCATAAGTTTCGTTTGCTAT

Gene: CTN_0304: Chaperone Hsp70
*
Thermotoga petrophila RKU-1

Site:
position = -179
score = 5.94261
sequence = TTATCATTCAAAAGTTTCATTTGCTAT

Gene: Tpet_0544: Chaperone Hsp70
*
Thermotoga naphthophila RKU-10

Site:
position = -179
score = 5.94261
sequence = TTATCATTCAAAAGTTTCATTTGCTAT

Gene: Tnap_0168: Chaperone Hsp70
*
Thermotoga lettingae TMO

Site:
position = -169
score = 5.87844
sequence = GTATCAGTCTATAATTACGAGTGCTAT

Gene: Tlet_0014: Chaperone Hsp70
*
Thermosipho africanus TCF52B

Site:
position = -59
score = 6.33068
sequence = TTATCACTCTTGACAAAAGACTGCTAA

Site:
position = -159
score = 5.16258
sequence = ATAACAAACTTATGTAACAATTGCTAT

Gene: THA_1433: Chaperone Hsp70
*
Thermosipho melanesiensis BI429

Site:
position = -157
score = 5.58445
sequence = ATAACAAACGAATGTTACGATTGCTAT

Site:
position = -57
score = 6.47169
sequence = TTATCACTCTTGACAATAGAGTGATAA

Gene: Tmel_1128: Chaperone Hsp70
*
Fervidobacterium nodosum Rt17-B1

Site:
position = -82
score = 6.41321
sequence = TTATCACTCTTGACAAATGATTGCTAA

Gene: Fnod_1209: Chaperone Hsp70
*
Petrotoga mobilis SJ95

Site:
position = -205
score = 5.71644
sequence = TTTTCACTCTTAGATTAAGAGTGATAT

Gene: Pmob_1649: Chaperone Hsp70
*
Thermotogales bacterium TBF 19.5.1

Site:
position = -82
score = 5.61923
sequence = ATGGCAAACTTGACATTCGATTGCTAA

Gene: Kole_0886: Chaperone Hsp70
Chaperone Hsp70
hsp20
 
Thermotoga maritima MSB8

Gene: TM0374: Chaperone Hsp20
 
Thermotoga sp. RQ2

Gene: TRQ2_0557: Chaperone Hsp20
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0305: Chaperone Hsp20
 
Thermotoga petrophila RKU-1

Gene: Tpet_0543: Chaperone Hsp20
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0169: Chaperone Hsp20
 
Thermotoga lettingae TMO

Gene: Tlet_0015: Chaperone Hsp20
 
Thermosipho africanus TCF52B

Gene: THA_1432: Chaperone Hsp20
 
Thermosipho melanesiensis BI429

Gene: Tmel_1127: Chaperone Hsp20
*
Fervidobacterium nodosum Rt17-B1

Site:
position = -244
score = 5.70555
sequence = TTATCATTATTAAGTTACAACTGATAA

Site:
position = -141
score = 6.49219
sequence = TTATCACTCTTGACAATTGAGTGATAA

Gene: Fnod_0102: Chaperone Hsp20
 
Petrotoga mobilis SJ95

Gene: Pmob_1650: Chaperone Hsp20
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_0885: Chaperone Hsp20
Chaperone Hsp20
clpB
 
Thermotoga maritima MSB8

Gene: TM1391: Chaperone protein
 
Thermotoga sp. RQ2

Gene: TRQ2_1438: Chaperone protein
 
Thermotoga neapolitana DSM 4359

Gene: CTN_1200: Chaperone protein
 
Thermotoga petrophila RKU-1

Gene: Tpet_1392: Chaperone protein
 
Thermotoga naphthophila RKU-10

Gene: Tnap_1412: Chaperone protein
 
Thermotoga lettingae TMO

Gene: Tlet_0016: Chaperone protein
 
Thermosipho africanus TCF52B

Gene: THA_686: Chaperone protein
 
Thermosipho melanesiensis BI429

Gene: Tmel_0597: Chaperone protein
*
Fervidobacterium nodosum Rt17-B1

Site:
position = -85
score = 6.04768
sequence = ATATCACTCTTGACATATAAGTGATAA

Gene: Fnod_0310: Chaperone protein
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_0884: Chaperone protein
Chaperone protein
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD