Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HcpR - Thermotogales

Properties
Regulator type: Transcription factor
Regulator family: CRP
Regulation mode: activator
Biological process: Nitrosative stress response
Effector: Nitric oxide
Phylum: Thermotogae
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 20 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Thermotoga maritima MSB8 2 2
Thermotoga sp. RQ2 2 2
Thermotoga neapolitana DSM 4359 1 1
Thermotoga petrophila RKU-1 2 2
Thermotoga naphthophila RKU-10 2 2
Thermotoga lettingae TMO 2 2
Thermosipho africanus TCF52B 2 2
Thermosipho melanesiensis BI429 2 1
Fervidobacterium nodosum Rt17-B1 2 2
Petrotoga mobilis SJ95 2 2
Thermotogales bacterium TBF 19.5.1 3 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hcpR
*
Thermotoga maritima MSB8

Site:
position = -28
score = 6.52216
sequence = TCTGTAACAATTGTTACGGG

Gene: TM1171: Transcriptional regulator HcpR, Crp/Fnr family
*
Thermotoga sp. RQ2

Site:
position = -31
score = 6.67411
sequence = TCCGTAACAATTGTTACGGG

Gene: TRQ2_1644: Transcriptional regulator HcpR, Crp/Fnr family
 
Thermotoga neapolitana DSM 4359

Gene: CTN_1404: Transcriptional regulator HcpR, Crp/Fnr family
*
Thermotoga petrophila RKU-1

Site:
position = -28
score = 6.2757
sequence = TCTGTAACAATTGTTACGAG

Gene: Tpet_1578: Transcriptional regulator HcpR, Crp/Fnr family
*
Thermotoga naphthophila RKU-10

Site:
position = -28
score = 6.2757
sequence = TCTGTAACAATTGTTACGAG

Gene: Tnap_1598: Transcriptional regulator HcpR, Crp/Fnr family
*
Thermotoga lettingae TMO

Site:
position = -20
score = 5.57334
sequence = GCGGTAACATATGATACAGA

Gene: Tlet_1357: Transcriptional regulator HcpR, Crp/Fnr family
 
Thermosipho africanus TCF52B

Gene: THA_1108: Transcriptional regulator HcpR, Crp/Fnr family
 
Thermosipho melanesiensis BI429

Gene: Tmel_0756: Transcriptional regulator HcpR, Crp/Fnr family
*
Fervidobacterium nodosum Rt17-B1

Site:
position = -229
score = 6.52625
sequence = TCCGTAACCTATGTTACGGA

Gene: Fnod_1303: Transcriptional regulator HcpR, Crp/Fnr family
*
Petrotoga mobilis SJ95

Site:
position = -52
score = 6.23237
sequence = TCAGTAACAAATGTTACGCA

Gene: Pmob_1162: Transcriptional regulator HcpR, Crp/Fnr family
*
Thermotogales bacterium TBF 19.5.1

Site:
position = -28
score = 6.56995
sequence = TCGGTAACATATGTTACGGA

Gene: Kole_1156: Transcriptional regulator HcpR, Crp/Fnr family
Transcriptional regulator HcpR, Crp/Fnr family
 
CRON 2.
ytfE
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B

Gene: THA_1028: Regulator of cell morphogenesis and NO signaling
*
Thermosipho melanesiensis BI429

Site:
position = -59
score = 5.91973
sequence = AGCGTAACATAAGTTACGGA

Gene: Tmel_0755: Regulator of cell morphogenesis and NO signaling
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
*
Thermotogales bacterium TBF 19.5.1

Site:
position = -86
score = 6.56995
sequence = TCCGTAACATATGTTACCGA

Gene: Kole_1155: Regulator of cell morphogenesis and NO signaling
Regulator of cell morphogenesis and NO signaling
hcp
*
Thermotoga maritima MSB8

Site:
position = -87
score = 6.52216
sequence = CCCGTAACAATTGTTACAGA

Gene: TM1172: Hydroxylamine reductase (EC 1.7.-.-)
*
Thermotoga sp. RQ2

Site:
position = -80
score = 6.67411
sequence = CCCGTAACAATTGTTACGGA

Gene: TRQ2_1643: Hydroxylamine reductase (EC 1.7.-.-)
*
Thermotoga neapolitana DSM 4359

Site:
position = -50
score = 6.67411
sequence = CCCGTAACAATTGTTACGGA

Gene: CTN_1403: Hydroxylamine reductase (EC 1.7.-.-)
*
Thermotoga petrophila RKU-1

Site:
position = -81
score = 6.2757
sequence = CTCGTAACAATTGTTACAGA

Gene: Tpet_1577: Hydroxylamine reductase (EC 1.7.-.-)
*
Thermotoga naphthophila RKU-10

Site:
position = -81
score = 6.2757
sequence = CTCGTAACAATTGTTACAGA

Gene: Tnap_1597: Hydroxylamine reductase (EC 1.7.-.-)
*
Thermotoga lettingae TMO

Site:
position = -79
score = 5.7091
sequence = TTCGTAACAAAAGTTACTGT

Gene: Tlet_0222: Hydroxylamine reductase (EC 1.7.-.-)
*2
Thermosipho africanus TCF52B

Site:
position = -79
score = 6.12784
sequence = TTCGTAACCTATGTTACAGA

Gene: THA_824: Hydroxylamine reductase (EC 1.7.-.-)

Site:
position = -84
score = 6.42599
sequence = TCCGTAACTAATGTTACAGA

Gene: THA_1919: Hydroxylamine reductase (EC 1.7.-.-)
 
Thermosipho melanesiensis BI429

Gene: Tmel_0754: Hydroxylamine reductase (EC 1.7.-.-)
*
Fervidobacterium nodosum Rt17-B1

Site:
position = -92
score = 6.52625
sequence = TCCGTAACATAGGTTACGGA

Gene: Fnod_1302: Hydroxylamine reductase (EC 1.7.-.-)
*
Petrotoga mobilis SJ95

Site:
position = -132
score = 6.23237
sequence = TGCGTAACATTTGTTACTGA

Gene: Pmob_1163: Hydroxylamine reductase (EC 1.7.-.-)
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_1154: Hydroxylamine reductase (EC 1.7.-.-)
Hydroxylamine reductase (EC 1.7.-.-)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD