Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ChiR - Thermotogales

Properties
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Chitobiose utilization
Effector: Chitobiose
Phylum: Thermotogae
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Thermotoga maritima MSB8 7 1
Thermotoga sp. RQ2 7 1
Thermotoga neapolitana DSM 4359 8 1
Thermotoga petrophila RKU-1 7 1
Thermotoga naphthophila RKU-10 3 1
Thermotoga lettingae TMO 5 1
Thermosipho africanus TCF52B 7 1
Thermosipho melanesiensis BI429 7 1
Fervidobacterium nodosum Rt17-B1
Petrotoga mobilis SJ95
Thermotogales bacterium TBF 19.5.1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
chiR
*
Thermotoga maritima MSB8

Site:
position = -27
score = 6.85177
sequence = AAGTTGTTTGCGGCATGCAACTA

Gene: TM0808: Regulator of chitobiose utilization ChiR, ROK family
*
Thermotoga sp. RQ2

Site:
position = -43
score = 6.85177
sequence = AAGTTGTTTGCGGCATGCAACTA

Gene: TRQ2_0118: Regulator of chitobiose utilization ChiR, ROK family
*
Thermotoga neapolitana DSM 4359

Site:
position = -44
score = 6.82158
sequence = TAGTTGCTTGCAACACGCAACTA

Gene: CTN_1770: Regulator of chitobiose utilization ChiR, ROK family
*
Thermotoga petrophila RKU-1

Site:
position = -43
score = 7.00517
sequence = AAGTTGTTTGCAGCATGCAACTA

Gene: Tpet_0120: Regulator of chitobiose utilization ChiR, ROK family
*
Thermotoga naphthophila RKU-10

Site:
position = -43
score = 7.00517
sequence = AAGTTGTTTGCAGCATGCAACTA

Gene: Tnap_0121: Regulator of chitobiose utilization ChiR, ROK family
*
Thermotoga lettingae TMO

Site:
position = -39
score = 6.33147
sequence = TAGTTGCAGTATGCAAGCAACTA

Gene: Tlet_0036: Regulator of chitobiose utilization ChiR, ROK family
*
Thermosipho africanus TCF52B

Site:
position = -42
score = 6.51994
sequence = TAGTTGATTGAAACAACCAACTA

Gene: THA_1058: Regulator of chitobiose utilization ChiR, ROK family
*
Thermosipho melanesiensis BI429

Site:
position = -38
score = 6.89973
sequence = TAGTTGATTGAAGCAATCAACTA

Gene: Tmel_0688: Regulator of chitobiose utilization ChiR, ROK family
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Regulator of chitobiose utilization ChiR, ROK family
cbsA
 
Thermotoga maritima MSB8

Gene: TM0809: Beta-hexosaminidase (EC 3.2.1.52)
 
Thermotoga sp. RQ2

Gene: TRQ2_0117: Beta-hexosaminidase (EC 3.2.1.52)
 2
Thermotoga neapolitana DSM 4359

Gene: CTN_1768: Beta-hexosaminidase (EC 3.2.1.52)

Gene: CTN_1769: Beta-hexosaminidase (EC 3.2.1.52)
 
Thermotoga petrophila RKU-1

Gene: Tpet_0119: Beta-hexosaminidase (EC 3.2.1.52)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0120: Beta-hexosaminidase (EC 3.2.1.52)
 
Thermotoga lettingae TMO

Gene: Tlet_0035: Beta-hexosaminidase (EC 3.2.1.52)
 
Thermosipho africanus TCF52B

Gene: THA_1059: Beta-hexosaminidase (EC 3.2.1.52)
 
Thermosipho melanesiensis BI429

Gene: Tmel_0689: Beta-hexosaminidase (EC 3.2.1.52)
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Beta-hexosaminidase (EC 3.2.1.52)
chiE
 
Thermotoga maritima MSB8

Gene: TM0810: Predicted chitobiose ABC transport system, sugar-binding protein
 
Thermotoga sp. RQ2

Gene: TRQ2_0116: Predicted chitobiose ABC transport system, sugar-binding protein
 
Thermotoga neapolitana DSM 4359

Gene: CTN_1767: Predicted chitobiose ABC transport system, sugar-binding protein
 
Thermotoga petrophila RKU-1

Gene: Tpet_0118: Predicted chitobiose ABC transport system, sugar-binding protein
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0119: Predicted chitobiose ABC transport system, sugar-binding protein
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Predicted chitobiose ABC transport system, sugar-binding protein
chiF
 
Thermotoga maritima MSB8

Gene: TM0811: Predicted chitobiose ABC transport system, permease protein 1
 
Thermotoga sp. RQ2

Gene: TRQ2_0115: Predicted chitobiose ABC transport system, permease protein 1
 
Thermotoga neapolitana DSM 4359

Gene: CTN_1766: Predicted chitobiose ABC transport system, permease protein 1
 
Thermotoga petrophila RKU-1

Gene: Tpet_0117: Predicted chitobiose ABC transport system, permease protein 1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Predicted chitobiose ABC transport system, permease protein 1
chiG
 
Thermotoga maritima MSB8

Gene: TM0812: Predicted chitobiose ABC transport system, permease protein 2
 
Thermotoga sp. RQ2

Gene: TRQ2_0114: Predicted chitobiose ABC transport system, permease protein 2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_1765: Predicted chitobiose ABC transport system, permease protein 2
 
Thermotoga petrophila RKU-1

Gene: Tpet_0116: Predicted chitobiose ABC transport system, permease protein 2
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0117: Predicted chitobiose ABC transport system, permease protein 2
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Predicted chitobiose ABC transport system, permease protein 2
nagB
 
Thermotoga maritima MSB8

Gene: TM0813: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
 
Thermotoga sp. RQ2

Gene: TRQ2_0113: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
 
Thermotoga neapolitana DSM 4359

Gene: CTN_1764: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
 
Thermotoga petrophila RKU-1

Gene: Tpet_0115: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0116: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
 
Thermotoga lettingae TMO

Gene: Tlet_1552: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
 
Thermosipho africanus TCF52B

Gene: THA_1063: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
 
Thermosipho melanesiensis BI429

Gene: Tmel_0693: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95

Gene: Pmob_1553: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_0736: Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
Glucosamine-6-phosphate deaminase [isomerizing], alternative (EC 3.5.99.6)
nagA
 
Thermotoga maritima MSB8

Gene: TM0814: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Thermotoga sp. RQ2

Gene: TRQ2_0112: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Thermotoga neapolitana DSM 4359

Gene: CTN_1763: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Thermotoga petrophila RKU-1

Gene: Tpet_0114: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0115: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Thermotoga lettingae TMO

Gene: Tlet_1990: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Thermosipho africanus TCF52B

Gene: THA_1064: N-acetylglucosamine-6-phosphate deacetylase
 
Thermosipho melanesiensis BI429

Gene: Tmel_0694: N-acetylglucosamine-6-phosphate deacetylase
 
Fervidobacterium nodosum Rt17-B1

Gene: Fnod_0810: N-acetylglucosamine-6-phosphate deacetylase
 
Petrotoga mobilis SJ95

Gene: Pmob_1552: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_0731: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25)
chiX
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO

Gene: Tlet_0034: Predicted chitobiose ABC transport system II, sugar-binding protein
 
Thermosipho africanus TCF52B

Gene: THA_1060: Predicted chitobiose ABC transport system II, sugar-binding protein
 
Thermosipho melanesiensis BI429

Gene: Tmel_0690: Predicted chitobiose ABC transport system II, sugar-binding protein
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Predicted chitobiose ABC transport system II, sugar-binding protein
chiY
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO

Gene: Tlet_0033: Predicted chitobiose ABC transport system II, permease protein 1
 
Thermosipho africanus TCF52B

Gene: THA_1061: Predicted chitobiose ABC transport system II, permease protein 1
 
Thermosipho melanesiensis BI429

Gene: Tmel_0691: Predicted chitobiose ABC transport system II, permease protein 1
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Predicted chitobiose ABC transport system II, permease protein 1
chiZ
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO

Gene: Tlet_0032: Predicted chitobiose ABC transport system, permease protein 2
 
Thermosipho africanus TCF52B

Gene: THA_1062: Predicted chitobiose ABC transport system, permease protein 2
 
Thermosipho melanesiensis BI429

Gene: Tmel_0692: Predicted chitobiose ABC transport system, permease protein 2
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Predicted chitobiose ABC transport system, permease protein 2
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD