Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog GluR - Thermotogales

Properties
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Glucose utilization; Trehalose utilization
Effector: Glucose
Phylum: Thermotogae
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Thermotoga maritima MSB8
Thermotoga sp. RQ2 7 2
Thermotoga neapolitana DSM 4359 8 2
Thermotoga petrophila RKU-1 5 1
Thermotoga naphthophila RKU-10 8 2
Thermotoga lettingae TMO
Thermosipho africanus TCF52B
Thermosipho melanesiensis BI429
Fervidobacterium nodosum Rt17-B1
Petrotoga mobilis SJ95
Thermotogales bacterium TBF 19.5.1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
amyE
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2
*
Thermotoga neapolitana DSM 4359

Site:
position = -387
score = 4.82591
sequence = ATTTgATTAtAccGTcAgTTAAc

Gene: CTN_0781: extracellular alpha-amylase precursor
*
Thermotoga petrophila RKU-1

Site:
position = -52
score = 5.99096
sequence = ATTTGATTATAACGTCATTTAAT

Gene: Tpet_0953: extracellular alpha-amylase precursor
*
Thermotoga naphthophila RKU-10

Site:
position = -52
score = 5.99096
sequence = ATTTGATTATAACGTCATTTAAT

Gene: Tnap_0601: extracellular alpha-amylase precursor
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1

Gene: Fnod_1683: extracellular alpha-amylase precursor
 
Petrotoga mobilis SJ95

Gene: Pmob_1428: extracellular alpha-amylase precursor
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_0461: extracellular alpha-amylase precursor
extracellular alpha-amylase precursor
treE
 
Thermotoga maritima MSB8
*
Thermotoga sp. RQ2

Site:
position = -48
score = 5.99096
sequence = ATTTGATTACAACGTCATTTAAC

Gene: TRQ2_0970: Trehalose ABC transporter, substrate-binding component
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0780: Trehalose ABC transporter, substrate-binding component
 
Thermotoga petrophila RKU-1

Gene: Tpet_0954: Trehalose ABC transporter, substrate-binding component
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0600: Trehalose ABC transporter, substrate-binding component
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B

Gene: THA_844: Trehalose ABC transporter, substrate-binding component
 
Thermosipho melanesiensis BI429

Gene: Tmel_1820: Trehalose ABC transporter, substrate-binding component
 
Fervidobacterium nodosum Rt17-B1

Gene: Fnod_0450: Trehalose ABC transporter, substrate-binding component
 
Petrotoga mobilis SJ95

Gene: Pmob_0138: Trehalose ABC transporter, substrate-binding component
 
Thermotogales bacterium TBF 19.5.1
Trehalose ABC transporter, substrate-binding component
treF
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2

Gene: TRQ2_0971: Trehalose ABC transporter, permease component 1
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0779: Trehalose ABC transporter, permease component 1
 
Thermotoga petrophila RKU-1

Gene: Tpet_0955: Trehalose ABC transporter, permease component 1
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0599: Trehalose ABC transporter, permease component 1
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B

Gene: THA_845: Trehalose ABC transporter, permease component 1
 
Thermosipho melanesiensis BI429

Gene: Tmel_1819: Trehalose ABC transporter, permease component 1
 
Fervidobacterium nodosum Rt17-B1

Gene: Fnod_0449: Trehalose ABC transporter, permease component 1
 
Petrotoga mobilis SJ95

Gene: Pmob_0028: Trehalose ABC transporter, permease component 1
 
Thermotogales bacterium TBF 19.5.1
Trehalose ABC transporter, permease component 1
treG
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2

Gene: TRQ2_0972: Trehalose ABC transporter, permease component 1
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0778: Trehalose ABC transporter, permease component 1
 
Thermotoga petrophila RKU-1

Gene: Tpet_0956: Trehalose ABC transporter, permease component 1
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0598: Trehalose ABC transporter, permease component 1
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B

Gene: THA_846: Trehalose ABC transporter, permease component 1
 
Thermosipho melanesiensis BI429

Gene: Tmel_1818: Trehalose ABC transporter, permease component 1
 
Fervidobacterium nodosum Rt17-B1

Gene: Fnod_0448: Trehalose ABC transporter, permease component 1
 
Petrotoga mobilis SJ95

Gene: Pmob_0029: Trehalose ABC transporter, permease component 1
 
Thermotogales bacterium TBF 19.5.1
Trehalose ABC transporter, permease component 1
gluR
 
Thermotoga maritima MSB8

Gene: TM1847: Predicted regulator of glucose and trehalose utilization, ROK family
 
Thermotoga sp. RQ2

Gene: TRQ2_0976: Predicted regulator of glucose and trehalose utilization, ROK family
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0774: Predicted regulator of glucose and trehalose utilization, ROK family
 
Thermotoga petrophila RKU-1

Gene: Tpet_0957: Predicted regulator of glucose and trehalose utilization, ROK family
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0594: Predicted regulator of glucose and trehalose utilization, ROK family
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Predicted regulator of glucose and trehalose utilization, ROK family
gluE
 
Thermotoga maritima MSB8
*
Thermotoga sp. RQ2

Site:
position = -121
score = 6.30633
sequence = ATTTAATTCCTTTGGAAATTAAT

Gene: TRQ2_0973: Glucose ABC transporter, substrate-binding component
*
Thermotoga neapolitana DSM 4359

Site:
position = -121
score = 6.26143
sequence = ATTTGATTCCGTTGGAAATTAAT

Gene: CTN_0777: Glucose ABC transporter, substrate-binding component
 
Thermotoga petrophila RKU-1
*
Thermotoga naphthophila RKU-10

Site:
position = -133
score = 6.30633
sequence = ATTTAATTCCTTTGGAAATTAAT

Gene: Tnap_0597: Glucose ABC transporter, substrate-binding component
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Glucose ABC transporter, substrate-binding component
gluF
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2

Gene: TRQ2_0974: Glucose ABC transporter, permease component
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0776: Glucose ABC transporter, permease component
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0596: Glucose ABC transporter, permease component
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Glucose ABC transporter, permease component
gluK
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2

Gene: TRQ2_0975: Glucose ABC transporter, ATP-binding component
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0775: Glucose ABC transporter, ATP-binding component
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0595: Glucose ABC transporter, ATP-binding component
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Glucose ABC transporter, ATP-binding component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD