Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog BglR - Thermotogales

Properties
Regulator type: Transcription factor
Regulator family: ROK
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Cellobiose
Phylum: Thermotogae
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Thermotoga maritima MSB8 9 1
Thermotoga sp. RQ2 9 1
Thermotoga neapolitana DSM 4359 12 1
Thermotoga petrophila RKU-1 9 1
Thermotoga naphthophila RKU-10 9 1
Thermotoga lettingae TMO 3 2
Thermosipho africanus TCF52B
Thermosipho melanesiensis BI429
Fervidobacterium nodosum Rt17-B1
Petrotoga mobilis SJ95
Thermotogales bacterium TBF 19.5.1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
bglX
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2
*
Thermotoga neapolitana DSM 4359

Site:
position = -49
score = 6.45303
sequence = AATTCCTTTCTGAGGAAGATAAT

Gene: CTN_0660: Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO

Gene: Tlet_1038: Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653
 
Thermosipho africanus TCF52B

Gene: THA_939: Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653
 
Thermosipho melanesiensis BI429

Gene: Tmel_0818: Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95

Gene: Pmob_1924: Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_2003: Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653
Predicted beta-glucoside-regulated ABC transport system, sugar binding component, COG1653
bglY
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0661: Predicted beta-glucoside-regulated ABC transport system, permease component 1, COG1175
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B

Gene: THA_940: Predicted beta-glucoside-regulated ABC transport system, permease component 1, COG1175
 
Thermosipho melanesiensis BI429

Gene: Tmel_0819: Predicted beta-glucoside-regulated ABC transport system, permease component 1, COG1175
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95

Gene: Pmob_1923: Predicted beta-glucoside-regulated ABC transport system, permease component 1, COG1175
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_2002: Predicted beta-glucoside-regulated ABC transport system, permease component 1, COG1175
Predicted beta-glucoside-regulated ABC transport system, permease component 1, COG1175
bglZ
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0662: Predicted beta-glucoside-regulated ABC transport system, permease component 2, COG0395
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B

Gene: THA_941: Predicted beta-glucoside-regulated ABC transport system, permease component 2, COG0395
 
Thermosipho melanesiensis BI429

Gene: Tmel_0820: Predicted beta-glucoside-regulated ABC transport system, permease component 2, COG0395
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95

Gene: Pmob_1922: Predicted beta-glucoside-regulated ABC transport system, permease component 2, COG0395
 
Thermotogales bacterium TBF 19.5.1

Gene: Kole_2001: Predicted beta-glucoside-regulated ABC transport system, permease component 2, COG0395
Predicted beta-glucoside-regulated ABC transport system, permease component 2, COG0395
bglR
*
Thermotoga maritima MSB8

Site:
position = -45
score = 6.78518
sequence = AATTTCTTTCTGAGGAAGATAGA

Gene: TM0032: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family
*
Thermotoga sp. RQ2

Site:
position = -45
score = 6.78518
sequence = AATTTCTTTCTGAGGAAGATAGA

Gene: TRQ2_0913: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0663: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family
*
Thermotoga petrophila RKU-1

Site:
position = 29
score = 6.78518
sequence = AATtTCTTTCTGAGgAAGATAga

Gene: Tpet_0891: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family
*
Thermotoga naphthophila RKU-10

Site:
position = -45
score = 6.78518
sequence = AATTTCTTTCTGAGGAAGATAGA

Gene: Tnap_0663: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family
*
Thermotoga lettingae TMO

Site:
position = -55
score = 6.32505
sequence = AAAATCTTTTTTAGAAAGATATT

Gene: Tlet_1037: Cellobiose-responsive regulator of beta-glucosides utilization, ROK family
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Cellobiose-responsive regulator of beta-glucosides utilization, ROK family
bglE
 
Thermotoga maritima MSB8

Gene: TM0031: Beta-glucoside ABC transport system, sugar-binding protein
 
Thermotoga sp. RQ2

Gene: TRQ2_0914: Beta-glucoside ABC transport system, sugar-binding protein
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0664: Beta-glucoside ABC transport system, sugar-binding protein
 
Thermotoga petrophila RKU-1

Gene: Tpet_0892: Beta-glucoside ABC transport system, sugar-binding protein
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0662: Beta-glucoside ABC transport system, sugar-binding protein
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Beta-glucoside ABC transport system, sugar-binding protein
bglF
 
Thermotoga maritima MSB8

Gene: TM0030: Beta-glucoside ABC transport system, permease protein 1
 
Thermotoga sp. RQ2

Gene: TRQ2_0915: Beta-glucoside ABC transport system, permease protein 1
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0665: Beta-glucoside ABC transport system, permease protein 1
 
Thermotoga petrophila RKU-1

Gene: Tpet_0893: Beta-glucoside ABC transport system, permease protein 1
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0661: Beta-glucoside ABC transport system, permease protein 1
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Beta-glucoside ABC transport system, permease protein 1
bglG
 
Thermotoga maritima MSB8

Gene: TM0029: Beta-glucoside ABC transport system, permease protein 2
 
Thermotoga sp. RQ2

Gene: TRQ2_0916: Beta-glucoside ABC transport system, permease protein 2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0666: Beta-glucoside ABC transport system, permease protein 2
 
Thermotoga petrophila RKU-1

Gene: Tpet_0894: Beta-glucoside ABC transport system, permease protein 2
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0660: Beta-glucoside ABC transport system, permease protein 2
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Beta-glucoside ABC transport system, permease protein 2
bglK
 
Thermotoga maritima MSB8

Gene: TM0028: Beta-glucoside ABC transport system, ATP-binding protein 1
 
Thermotoga sp. RQ2

Gene: TRQ2_0917: Beta-glucoside ABC transport system, ATP-binding protein 1
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0667: Beta-glucoside ABC transport system, ATP-binding protein 1
 
Thermotoga petrophila RKU-1

Gene: Tpet_0895: Beta-glucoside ABC transport system, ATP-binding protein 1
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0659: Beta-glucoside ABC transport system, ATP-binding protein 1
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Beta-glucoside ABC transport system, ATP-binding protein 1
bglL
 
Thermotoga maritima MSB8

Gene: TM0027: Beta-glucoside ABC transport system, ATP-binding protein 2
 
Thermotoga sp. RQ2

Gene: TRQ2_0918: Beta-glucoside ABC transport system, ATP-binding protein 2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0668: Beta-glucoside ABC transport system, ATP-binding protein 2
 
Thermotoga petrophila RKU-1

Gene: Tpet_0896: Beta-glucoside ABC transport system, ATP-binding protein 2
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0658: Beta-glucoside ABC transport system, ATP-binding protein 2
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Beta-glucoside ABC transport system, ATP-binding protein 2
TM0026
 
Thermotoga maritima MSB8

Gene: TM0026: Hypothetical protein TM0026, BglR regulon
 
Thermotoga sp. RQ2

Gene: TRQ2_0919: Hypothetical protein TM0026, BglR regulon
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0669: Hypothetical protein TM0026, BglR regulon
 
Thermotoga petrophila RKU-1

Gene: Tpet_0897: Hypothetical protein TM0026, BglR regulon
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0657: Hypothetical protein TM0026, BglR regulon
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Hypothetical protein TM0026, BglR regulon
bglB
 
Thermotoga maritima MSB8

Gene: TM0025: Beta-glucosidase (EC 3.2.1.21)
 
Thermotoga sp. RQ2

Gene: TRQ2_0920: Beta-glucosidase (EC 3.2.1.21)
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0670: Beta-glucosidase (EC 3.2.1.21)
 
Thermotoga petrophila RKU-1

Gene: Tpet_0898: Beta-glucosidase (EC 3.2.1.21)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0656: Beta-glucosidase (EC 3.2.1.21)
*
Thermotoga lettingae TMO

Site:
position = -121
score = 6.00138
sequence = TAAATCTTTTTCAGAAAGATAAA

Gene: Tlet_1036: Beta-glucosidase (EC 3.2.1.21)
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Beta-glucosidase (EC 3.2.1.21)
lamA
 
Thermotoga maritima MSB8

Gene: TM0024: Laminarinase (EC 3.2.1.39)
 
Thermotoga sp. RQ2

Gene: TRQ2_0921: Laminarinase (EC 3.2.1.39)
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0671: Laminarinase (EC 3.2.1.39)
 
Thermotoga petrophila RKU-1

Gene: Tpet_0899: Laminarinase (EC 3.2.1.39)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0655: Laminarinase (EC 3.2.1.39)
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Laminarinase (EC 3.2.1.39)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD