Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog AraR - Thermotogales

Properties
Regulator type: Transcription factor
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Arabinose utilization
Effector: Arabinose
Phylum: Thermotogae
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 35 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Thermotoga maritima MSB8 9 3
Thermotoga sp. RQ2 21 5
Thermotoga neapolitana DSM 4359 3 2
Thermotoga petrophila RKU-1 22 5
Thermotoga naphthophila RKU-10 10 3
Thermotoga lettingae TMO 10 2
Thermosipho africanus TCF52B
Thermosipho melanesiensis BI429
Fervidobacterium nodosum Rt17-B1
Petrotoga mobilis SJ95
Thermotogales bacterium TBF 19.5.1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
araN-II
 
Thermotoga maritima MSB8
*
Thermotoga sp. RQ2

Site:
position = -50
score = 5.74643
sequence = AAATTGGTACGTACCTATCT

Site:
position = -233
score = 5.35162
sequence = CATTTTGTACGTACATATAT

Gene: TRQ2_0661: Predicted arabinose ABC transporter, substrate binding protein
 
Thermotoga neapolitana DSM 4359
*
Thermotoga petrophila RKU-1

Site:
position = -233
score = 5.35162
sequence = CATTTTGTACGTACATATAT

Site:
position = -50
score = 5.74643
sequence = AAATTGGTACGTACCTATCT

Gene: Tpet_0636: Predicted arabinose ABC transporter, substrate binding protein
 
Thermotoga naphthophila RKU-10
*
Thermotoga lettingae TMO

Site:
position = -169
score = 4.99913
sequence = TAATTTGTATGTACATATAT

Gene: Tlet_1143: Predicted arabinose ABC transporter, substrate binding protein
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Predicted arabinose ABC transporter, substrate binding protein
araP-II
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2

Gene: TRQ2_0660: Alpha-arabinosides ABC transport system, permease protein 1
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1

Gene: Tpet_0635: Alpha-arabinosides ABC transport system, permease protein 1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO

Gene: Tlet_1144: Alpha-arabinosides ABC transport system, permease protein 1
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Alpha-arabinosides ABC transport system, permease protein 1
araQ-II
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2

Gene: TRQ2_0659: Alpha-arabinosides ABC transport system, permease protein 2
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1

Gene: Tpet_0634: Alpha-arabinosides ABC transport system, permease protein 2
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO

Gene: Tlet_1145: Alpha-arabinosides ABC transport system, permease protein 2
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Alpha-arabinosides ABC transport system, permease protein 2
abf3
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2

Gene: TRQ2_0658: Alpha-N-arabinofuranosidase II (EC 3.2.1.55)
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1

Gene: Tpet_0633: Alpha-N-arabinofuranosidase II (EC 3.2.1.55)
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO

Gene: Tlet_1147: Alpha-N-arabinofuranosidase II (EC 3.2.1.55)
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Alpha-N-arabinofuranosidase II (EC 3.2.1.55)
xylX
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2

Gene: TRQ2_0657: Secreted glycosyl hydrolase, similar to xylosidase
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1

Gene: Tpet_0632: Secreted glycosyl hydrolase, similar to xylosidase
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Secreted glycosyl hydrolase, similar to xylosidase
abfA
 
Thermotoga maritima MSB8

Gene: TM0281: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Thermotoga sp. RQ2

Gene: TRQ2_0656: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0403: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Thermotoga petrophila RKU-1

Gene: Tpet_0631: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0911: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Thermotoga lettingae TMO

Gene: Tlet_1148: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Alpha-N-arabinofuranosidase (EC 3.2.1.55)
araM
 
Thermotoga maritima MSB8

Gene: TM0282: L-arabinose-specific 1-epimerase (mutarotase)
 
Thermotoga sp. RQ2

Gene: TRQ2_0655: L-arabinose-specific 1-epimerase (mutarotase)
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0402: L-arabinose-specific 1-epimerase (mutarotase)
 
Thermotoga petrophila RKU-1

Gene: Tpet_0630: L-arabinose-specific 1-epimerase (mutarotase)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0912: L-arabinose-specific 1-epimerase (mutarotase)
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
L-arabinose-specific 1-epimerase (mutarotase)
araD
 
Thermotoga maritima MSB8

Gene: TM0283: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Thermotoga sp. RQ2

Gene: TRQ2_0654: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0401: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Thermotoga petrophila RKU-1

Gene: Tpet_0629: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0915: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Thermotoga lettingae TMO

Gene: Tlet_1139: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
araB
 
Thermotoga maritima MSB8

Gene: TM0284: Ribulokinase (EC 2.7.1.16)
 
Thermotoga sp. RQ2

Gene: TRQ2_0653: Ribulokinase (EC 2.7.1.16)
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0400: Ribulokinase (EC 2.7.1.16)
 
Thermotoga petrophila RKU-1

Gene: Tpet_0628: Ribulokinase (EC 2.7.1.16)
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0916: Ribulokinase (EC 2.7.1.16)
 
Thermotoga lettingae TMO

Gene: Tlet_1150: Ribulokinase (EC 2.7.1.16)
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Ribulokinase (EC 2.7.1.16)
araW
 
Thermotoga maritima MSB8

Gene: TM0285: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
 
Thermotoga sp. RQ2

Gene: TRQ2_0652: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0399: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
 
Thermotoga petrophila RKU-1

Gene: Tpet_0627: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0917: Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Predicted glycerol-1-phosphate dehydrogenase, arabinose operon
xynB
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO

Gene: Tlet_1146: Endo-1,4-beta-xylanase
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Endo-1,4-beta-xylanase
araA-II
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO

Gene: Tlet_1149: Predicted L-arabinose isomerase (EC 5.3.1.4)
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Predicted L-arabinose isomerase (EC 5.3.1.4)
glsA
*
Thermotoga maritima MSB8

Site:
position = -44
score = 5.93951
sequence = AATAATGTACGTACCTAAAT

Gene: TM0280: Putative glycosyl hydrolase of unknown function (DUF1680)
*
Thermotoga sp. RQ2

Site:
position = -58
score = 5.93951
sequence = AATAATGTACGTACCTAAAT

Gene: TRQ2_0668: Putative glycosyl hydrolase of unknown function (DUF1680)
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0404: Putative glycosyl hydrolase of unknown function (DUF1680)
*
Thermotoga petrophila RKU-1

Site:
position = -55
score = 5.03261
sequence = GATAATATACGTACCTAAAT

Gene: Tpet_0643: Putative glycosyl hydrolase of unknown function (DUF1680)
*
Thermotoga naphthophila RKU-10

Site:
position = -55
score = 5.03261
sequence = GATAATATACGTACCTAAAT

Gene: Tnap_0910: Putative glycosyl hydrolase of unknown function (DUF1680)
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Putative glycosyl hydrolase of unknown function (DUF1680)
Tnap_0913
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1
*
Thermotoga naphthophila RKU-10

Site:
position = -56
score = 4.89355
sequence = TATAATGTACGTACCTATCA

Gene: Tnap_0913: predicted arabinose ABC transporter, sugar-binding protein
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
predicted arabinose ABC transporter, sugar-binding protein
Tnap_0914
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0914: predicted arabinose ABC transporter, permease component
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
predicted arabinose ABC transporter, permease component
araR
 
Thermotoga maritima MSB8

Gene: TM0275: Transcriptional repressor of arabinoside utilization operon, GntR family
 
Thermotoga sp. RQ2

Gene: TRQ2_0673: Transcriptional repressor of arabinoside utilization operon, GntR family
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0410: Transcriptional repressor of arabinoside utilization operon, GntR family
 
Thermotoga petrophila RKU-1

Gene: Tpet_0649: Transcriptional repressor of arabinoside utilization operon, GntR family
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0905: Transcriptional repressor of arabinoside utilization operon, GntR family
*
Thermotoga lettingae TMO

Site:
position = 27
score = 5.34936
sequence = ATTTATGTACGTACGTTTAC

Gene: Tlet_1138: Transcriptional repressor of arabinoside utilization operon, GntR family
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Transcriptional repressor of arabinoside utilization operon, GntR family
 
CRON 2.
araA
*
Thermotoga maritima MSB8

Site:
position = -164
score = 4.7066
sequence = ATAACGGTACGTACCGATGG

Site:
position = -62
score = 6.28709
sequence = ATAATGGTACGTACTTTTAT

Gene: TM0276: L-arabinose isomerase (EC 5.3.1.4)
*
Thermotoga sp. RQ2

Site:
position = -62
score = 6.51559
sequence = ATAAAGGTACGTACTTTTAT

Site:
position = -164
score = 4.7066
sequence = ATAACGGTACGTACCGATGG

Gene: TRQ2_0672: L-arabinose isomerase (EC 5.3.1.4)
*
Thermotoga neapolitana DSM 4359

Site:
position = -62
score = 6.18535
sequence = ATAAAGGTACGTACTTTTGT

Site:
position = -165
score = 4.70179
sequence = ATATCGGTACGTACCAGTTG

Gene: CTN_0409: L-arabinose isomerase (EC 5.3.1.4)
*
Thermotoga petrophila RKU-1

Site:
position = -62
score = 6.51559
sequence = ATAAAGGTACGTACTTTTAT

Site:
position = -164
score = 4.7066
sequence = ATAACGGTACGTACCGATGG

Gene: Tpet_0648: L-arabinose isomerase (EC 5.3.1.4)
*
Thermotoga naphthophila RKU-10

Site:
position = -62
score = 6.51559
sequence = ATAAAGGTACGTACTTTTAT

Site:
position = -164
score = 4.7066
sequence = ATAACGGTACGTACCGATGG

Gene: Tnap_0906: L-arabinose isomerase (EC 5.3.1.4)
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
L-arabinose isomerase (EC 5.3.1.4)
 
CRON 3.
abf6
 
Thermotoga maritima MSB8
*2
Thermotoga sp. RQ2

Site:
position = -221
score = 5.74643
sequence = AGATAGGTACGTACCAATTT

Site:
position = -38
score = 5.35162
sequence = ATATATGTACGTACAAAATG

Gene: TRQ2_0662: Predicted Aapha-N-arabinofuranosidase (EC 3.2.1.55)

Gene: TRQ2_0664: Predicted Aapha-N-arabinofuranosidase (EC 3.2.1.55)
 
Thermotoga neapolitana DSM 4359
*2
Thermotoga petrophila RKU-1

Site:
position = -221
score = 5.74643
sequence = AGATAGGTACGTACCAATTT

Site:
position = -38
score = 5.35162
sequence = ATATATGTACGTACAAAATG

Gene: Tpet_0637: Predicted Aapha-N-arabinofuranosidase (EC 3.2.1.55)

Gene: Tpet_0639: Predicted Aapha-N-arabinofuranosidase (EC 3.2.1.55)
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Predicted Aapha-N-arabinofuranosidase (EC 3.2.1.55)
lamG1
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2

Gene: TRQ2_0663: Laminin G domain-containing protein
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1

Gene: Tpet_0638: Laminin G domain-containing protein
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Laminin G domain-containing protein
conA1
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2

Gene: TRQ2_0665: Con A-like domain-containing protein
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1

Gene: Tpet_0640: Con A-like domain-containing protein
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Con A-like domain-containing protein
conA2
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2

Gene: TRQ2_0666: Con A-like domain-containing protein
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1

Gene: Tpet_0641: Con A-like domain-containing protein
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Con A-like domain-containing protein
lamG2
 
Thermotoga maritima MSB8
 
Thermotoga sp. RQ2

Gene: TRQ2_0667: Laminin G domain-containing protein
 
Thermotoga neapolitana DSM 4359
 
Thermotoga petrophila RKU-1

Gene: Tpet_0642: Laminin G domain-containing protein
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Laminin G domain-containing protein
 
CRON 4.
araE
 
Thermotoga maritima MSB8
*
Thermotoga sp. RQ2

Site:
position = -150
score = 6.51559
sequence = ATAAAAGTACGTACCTTTAT

Site:
position = -48
score = 4.7066
sequence = CCATCGGTACGTACCGTTAT

Gene: TRQ2_0671: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
*
Thermotoga neapolitana DSM 4359

Site:
position = -136
score = 6.18535
sequence = ACAAAAGTACGTACCTTTAT

Site:
position = -33
score = 4.70179
sequence = CAACTGGTACGTACCGATAT

Gene: CTN_0408: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
*2
Thermotoga petrophila RKU-1

Site:
position = -150
score = 6.51559
sequence = ATAAAAGTACGTACCTTTAT

Site:
position = -48
score = 4.7066
sequence = CCATCGGTACGTACCGTTAT

Gene: Tpet_0647: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein

Gene: Tpet_0646: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
*
Thermotoga naphthophila RKU-10

Site:
position = -150
score = 6.51559
sequence = ATAAAAGTACGTACCTTTAT

Site:
position = -48
score = 4.7066
sequence = CCATCGGTACGTACCGTTAT

Gene: Tnap_0907: Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Predicted arabinosides or arabinose ABC transport system, substrate-binding protein
araF
*
Thermotoga maritima MSB8

Site:
position = -1396
score = 4.7066
sequence = ccAtcGGTACGTACCgTTAT

Site:
position = -1498
score = 6.28709
sequence = ATAAAaGTACGTACCaTTAT

Gene: TM0278: Predicted arabinosides or arabinose ABC transport system, permease protein 1
 
Thermotoga sp. RQ2

Gene: TRQ2_0670: Predicted arabinosides or arabinose ABC transport system, permease protein 1
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0406: Predicted arabinosides or arabinose ABC transport system, permease protein 1
 
Thermotoga petrophila RKU-1

Gene: Tpet_0645: Predicted arabinosides or arabinose ABC transport system, permease protein 1
 
Thermotoga naphthophila RKU-10
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Predicted arabinosides or arabinose ABC transport system, permease protein 1
araG
 
Thermotoga maritima MSB8

Gene: TM0279: Predicted arabinosides or arabinose ABC transport system, permease protein 2
 
Thermotoga sp. RQ2

Gene: TRQ2_0669: Predicted arabinosides or arabinose ABC transport system, permease protein 2
 
Thermotoga neapolitana DSM 4359

Gene: CTN_0405: Predicted arabinosides or arabinose ABC transport system, permease protein 2
 
Thermotoga petrophila RKU-1

Gene: Tpet_0644: Predicted arabinosides or arabinose ABC transport system, permease protein 2
 
Thermotoga naphthophila RKU-10

Gene: Tnap_0909: Predicted arabinosides or arabinose ABC transport system, permease protein 2
 
Thermotoga lettingae TMO
 
Thermosipho africanus TCF52B
 
Thermosipho melanesiensis BI429
 
Fervidobacterium nodosum Rt17-B1
 
Petrotoga mobilis SJ95
 
Thermotogales bacterium TBF 19.5.1
Predicted arabinosides or arabinose ABC transport system, permease protein 2
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD