Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog Zur - Staphylococcaceae

Properties
Regulator type: Transcription factor
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 56 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Staphylococcus aureus subsp. aureus N315 12 8
Staphylococcus capitis SK14 11 9
Staphylococcus epidermidis ATCC 12228 11 7
Staphylococcus carnosus subsp. carnosus TM300 12 8
Staphylococcus haemolyticus JCSC1435 12 10
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 9 7
Macrococcus caseolyticus JCSC5402 2 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
znuC
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -69
score = 5.54845
sequence = TGAGTCGTAAACATTACTGTTTA

Gene: SA1385: Zinc ABC transporter, ATP-binding protein ZnuC
*
Staphylococcus capitis SK14

Site:
position = -66
score = 6.14233
sequence = TTAGTCGTAAACATTACTATTTA

Gene: STACA0001_1794: Zinc ABC transporter, ATP-binding protein ZnuC
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -58
score = 5.76501
sequence = ATAGTCGTAAACATTACTATTTA

Gene: SE1243: Zinc ABC transporter, ATP-binding protein ZnuC
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -65
score = 6.17882
sequence = TTAATCGTAAGCATTACAATTTA

Gene: Sca_1177: Zinc ABC transporter, ATP-binding protein ZnuC
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -66
score = 6.18966
sequence = CAAGTCGTAAACATTACTATTTA

Gene: SH1360: Zinc ABC transporter, ATP-binding protein ZnuC
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -66
score = 6.07766
sequence = TAATTCGGAAACATTACTATTTA

Gene: SSP1200: Zinc ABC transporter, ATP-binding protein ZnuC
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_1206: Zinc ABC transporter, ATP-binding protein ZnuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
 
Staphylococcus aureus subsp. aureus N315

Gene: SA1384: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Staphylococcus capitis SK14

Gene: STACA0001_1793: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Staphylococcus epidermidis ATCC 12228

Gene: SE1242: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_1176: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Staphylococcus haemolyticus JCSC1435

Gene: SH1361: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP1201: Zinc ABC transporter, inner membrane permease protein ZnuB
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_1205: Zinc ABC transporter, inner membrane permease protein ZnuB
Zinc ABC transporter, inner membrane permease protein ZnuB
zur
 
Staphylococcus aureus subsp. aureus N315

Gene: SA1383: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Staphylococcus capitis SK14

Gene: STACA0001_1792: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Staphylococcus epidermidis ATCC 12228

Gene: SE1241: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_1175: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Staphylococcus haemolyticus JCSC1435

Gene: SH1362: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP1202: Zinc homeostasis transcriptional regulator Zur, Fur family
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_1204: Zinc homeostasis transcriptional regulator Zur, Fur family
Zinc homeostasis transcriptional regulator Zur, Fur family
 
CRON 2.
znuA2
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -35
score = 6.14152
sequence = TAAAGCGTAACAATTTCGATTTA

Site:
position = -226
score = 6.82936
sequence = AAAAACGTAATTATTACGATTTA

Gene: SE0193: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Staphylococcus carnosus subsp. carnosus TM300
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -35
score = 6.40515
sequence = TAAAACGTAATGATTTTGATTTA

Site:
position = -188
score = 6.97268
sequence = CAAATCGTAATTATTACTATTTA

Gene: SH0125: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402
Zinc ABC transporter, periplasmic-binding protein ZnuA
 
CRON 3.
zinT
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -34
score = 6.64591
sequence = TAAAACGTAAAGATTACTATTTA

Gene: SA2194: Candidate zinc-binding lipoprotein ZinT
*
Staphylococcus capitis SK14

Site:
position = -34
score = 7.2575
sequence = TAAATCGTAATAATTACTATTTA

Gene: STACA0001_1070: Candidate zinc-binding lipoprotein ZinT
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -34
score = 7.2575
sequence = TAAATCGTAATTATTACTATTTA

Gene: SH0645: Candidate zinc-binding lipoprotein ZinT
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -36
score = 6.88018
sequence = TAAATCGTAACAATTACTATTTA

Gene: SSP0490: Candidate zinc-binding lipoprotein ZinT
 
Macrococcus caseolyticus JCSC5402
Candidate zinc-binding lipoprotein ZinT
 
CRON 4.
yciC
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -50
score = 6.41235
sequence = TAAAACGGAATTATTCCTATTTA

Gene: SA0410: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Staphylococcus capitis SK14

Site:
position = -43
score = 7.07246
sequence = TAAAACGTAATAATTACTATTTA

Gene: STACA0001_1465: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -43
score = 7.07246
sequence = TAAAACGTAATAATTACTATTTA

Gene: SE2335: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -58
score = 7.05958
sequence = TAAATCGTAATTATTACGATTAA

Gene: Sca_1955: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -44
score = 7.20669
sequence = TAAAACGTAATTATTACGATTTA

Gene: SH0144: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
*
Macrococcus caseolyticus JCSC5402

Site:
position = -35
score = 6.37494
sequence = TAAAACGTAATGATTACGAATTG

Gene: MCCL_0991: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
 
CRON 5.
Sca_0100
 
Staphylococcus aureus subsp. aureus N315
*
Staphylococcus capitis SK14

Site:
position = -33
score = 6.13032
sequence = TAAATCGTAATAATTTCGATTGG

Gene: STACA0001_0760: putative alkylmercury lyase
 
Staphylococcus epidermidis ATCC 12228
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -51
score = 6.063
sequence = TAAATCGAAATCATTACGCTTAA

Gene: Sca_0100: putative alkylmercury lyase
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402
putative alkylmercury lyase
 
CRON 6.
SA2370
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -69
score = 7.39173
sequence = TAAATCGTAATTATTACGATTTA

Gene: SA2370: hypothetical protein
 
Staphylococcus capitis SK14
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -53
score = 6.82936
sequence = TAAATCGTAATAATTACGTTTTT

Site:
position = -244
score = 6.14152
sequence = TAAATCGAAATTGTTACGCTTTA

Gene: SE0191: hypothetical protein
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -83
score = 6.44897
sequence = TAAAACATAACGATTACGATTTA

Gene: Sca_1906: hypothetical protein
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402
hypothetical protein
SA2369
 
Staphylococcus aureus subsp. aureus N315

Gene: SA2369: hypothetical protein
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0189: hypothetical protein
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_1905: hypothetical protein
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402
hypothetical protein
SA2368
 
Staphylococcus aureus subsp. aureus N315

Gene: SA2368: hypothetical protein
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0188: hypothetical protein
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_1904: hypothetical protein
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -101
score = 6.97268
sequence = TAAATAGTAATAATTACGATTTG

Site:
position = -254
score = 6.40515
sequence = TAAATCAAAATCATTACGTTTTA

Gene: SH0124: hypothetical protein
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402
hypothetical protein
 
CRON 7.
SA2203
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -126
score = 6.94877
sequence = TAAATAGTAATGATTACGTTTTA

Gene: SA2203: putative MFS family major facilitator transporter
*
Staphylococcus capitis SK14

Site:
position = -145
score = 7.2575
sequence = TAAATAGTAATTATTACGATTTA

Gene: STACA0001_1062: putative MFS family major facilitator transporter
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -120
score = 7.2575
sequence = TAAATAGTAATTATTACGATTTA

Gene: SH0638: putative MFS family major facilitator transporter
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -168
score = 7.2575
sequence = TAAATAGTAATTATTACGATTTA

Gene: SSP0485: putative MFS family major facilitator transporter
 
Macrococcus caseolyticus JCSC5402
putative MFS family major facilitator transporter
 
CRON 8.
SA0806
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -42
score = 6.43897
sequence = TAAATCGTAACGATTACGCTTTA

Gene: SA0806: hypothetical protein
*
Staphylococcus capitis SK14

Site:
position = -52
score = 6.83637
sequence = TAAATAGTAATTATTTCGATTTA

Gene: STACA0001_0181: hypothetical protein
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -42
score = 7.20669
sequence = TAAATCGTAATAATTACGTTTTA

Gene: SE0639: hypothetical protein
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -36
score = 6.97059
sequence = TAAATCGAAATTATTACGATTTA

Gene: Sca_0550: hypothetical protein
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -42
score = 7.20669
sequence = TAAATCGTAATTATTACGTTTTA

Gene: SH2006: hypothetical protein
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -40
score = 7.39173
sequence = TAAATCGTAATTATTACGATTTA

Gene: SSP1830: hypothetical protein
 
Macrococcus caseolyticus JCSC5402
hypothetical protein
 
CRON 9.
rpsN2
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -45
score = 7.1069
sequence = TAAATCGTAATAATTACGATTTG

Gene: SA1171: 30S ribosomal protein S14
*
Staphylococcus capitis SK14

Site:
position = -42
score = 7.20669
sequence = TAAAACGTAATAATTACGATTTA

Gene: STACA0001_1579: 30S ribosomal protein S14
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -42
score = 6.92186
sequence = TAAAACGTAATTATTACGATTTG

Gene: SE1018: 30S ribosomal protein S14
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -54
score = 6.68225
sequence = TAAATCGTAATAATTACGATTAT

Gene: Sca_0977: 30S ribosomal protein S14
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -43
score = 7.20669
sequence = TAAAACGTAATAATTACGATTTA

Gene: SH1571: 30S ribosomal protein S14
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -43
score = 6.92186
sequence = TAAAACGTAATAATTACGATTTG

Gene: SSP1421: 30S ribosomal protein S14
 
Macrococcus caseolyticus JCSC5402
30S ribosomal protein S14
 
CRON 10.
rpmG2
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -38
score = 5.3535
sequence = TAAATCGTAAAGATTCCTAACAA

Gene: SAS042: 50S ribosomal protein L33
*
Staphylococcus capitis SK14

Site:
position = -43
score = 5.31435
sequence = TAAATCGTAAGAATTCCTAACAA

Gene: STACA0001_1578: 50S ribosomal protein L33
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -43
score = 5.31435
sequence = TAAATCGTAAGAATTCCTAACAA

Gene: SE1017: 50S ribosomal protein L33
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -227
score = 6.68225
sequence = ATAATCGTAATTATTACGATTTA

Gene: Sca_0976: 50S ribosomal protein L33
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -43
score = 6.46175
sequence = TAAATCGTAAGTATTCCTATTTA

Gene: SH1572: 50S ribosomal protein L33
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -39
score = 7.07246
sequence = TAAAACGTAATAATTACTATTTA

Gene: SSP1422: 50S ribosomal protein L33
 
Macrococcus caseolyticus JCSC5402
50S ribosomal protein L33
 
CRON 11.
znuA
 
Staphylococcus aureus subsp. aureus N315
*
Staphylococcus capitis SK14

Site:
position = -36
score = 5.3395
sequence = ATAAACGAAATAATTACGCTTTG

Gene: STACA0001_0989: Zinc ABC transporter, periplasmic-binding protein ZnuA
 
Staphylococcus epidermidis ATCC 12228

Gene: SE2068: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -40
score = 6.27476
sequence = TAAACCATAATGATTACGATTTG

Gene: Sca_1971: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -34
score = 5.37094
sequence = AAAAACGAATTTATTACGTTTTG

Gene: SH0551: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -35
score = 5.18587
sequence = TTTAACGAAATAATTTCGATTTG

Gene: SSP0388: Zinc ABC transporter, periplasmic-binding protein ZnuA
*
Macrococcus caseolyticus JCSC5402

Site:
position = -35
score = 5.72088
sequence = TAAAACGTAACGATTACGAAATA

Site:
position = -168
score = 6.37494
sequence = CAATTCGTAATCATTACGTTTTA

Gene: MCCL_0992: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD