Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog HisR - Staphylococcaceae

Properties
Regulator type: Transcription factor
Regulator family: TrpR
Regulation mode: repressor
Biological process: Histidine biosynthesis
Effector: Histidine
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Staphylococcus aureus subsp. aureus N315 13 4
Staphylococcus capitis SK14 4 3
Staphylococcus epidermidis ATCC 12228 12 4
Staphylococcus carnosus subsp. carnosus TM300 13 4
Staphylococcus haemolyticus JCSC1435 4 3
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 13 4
Macrococcus caseolyticus JCSC5402 3 2
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hisR
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -62
score = 5.16946
sequence = CACTTTAATAGATTAATGCG

Gene: SA1723: Predicted histidine repressor, TrpR family
*
Staphylococcus capitis SK14

Site:
position = -60
score = 5.07424
sequence = CACTTTAACTAATTAGTACG

Gene: STACA0001_1960: Predicted histidine repressor, TrpR family
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -60
score = 5.03122
sequence = CACTTTAACGAATTAGTAAG

Gene: SE1592: Predicted histidine repressor, TrpR family
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -60
score = 5.08992
sequence = CACTTTAACGTATTAGTACG

Gene: Sca_1481: Predicted histidine repressor, TrpR family
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -65
score = 5.43956
sequence = CACTTTAACTATTTAATGCG

Gene: SH1044: Predicted histidine repressor, TrpR family
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -61
score = 5.06836
sequence = CACTTTAATGTACTAATACG

Gene: SSP0883: Predicted histidine repressor, TrpR family
 
Macrococcus caseolyticus JCSC5402
Predicted histidine repressor, TrpR family
 
CRON 2.
yuiF
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -38
score = 5.04842
sequence = CGCTTTAGTTCGATAGAGCG

Gene: SA0804: Histidine permease
*
Staphylococcus capitis SK14

Site:
position = -39
score = 4.87058
sequence = TACTTTAGTTCGATAGAGTG

Gene: STACA0001_0183: Histidine permease
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -37
score = 4.87058
sequence = TACTTTAGTTCGATAGAGTG

Gene: SE0637: Histidine permease
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -37
score = 4.22076
sequence = TGCTTTAGTTCGATAACGTA

Gene: Sca_0548: Histidine permease
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -37
score = 4.86297
sequence = TACTTTAGTTCGGTAGAGAG

Gene: SH2008: Histidine permease
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -38
score = 4.46835
sequence = TACTTTAGTTCGATAACGTG

Gene: SSP1832: Histidine permease
*
Macrococcus caseolyticus JCSC5402

Site:
position = -47
score = 4.22627
sequence = TACTTTAGTATGCTAATATA

Gene: MCCL_0570: Histidine permease
Histidine permease
SA0805
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0805: putative esterase
 
Staphylococcus capitis SK14

Gene: STACA0001_0182: putative esterase
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0638: putative esterase
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0549: putative esterase
 
Staphylococcus haemolyticus JCSC1435

Gene: SH2007: putative esterase
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP1831: putative esterase
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0571: putative esterase
putative esterase
 
CRON 3.
SA0417
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -27
score = 5.5165
sequence = CGCTTTAACGCTTTAAAGGA

Gene: SA0417: putative sodium-dependent transporter
*
Staphylococcus capitis SK14

Site:
position = -30
score = 5.57261
sequence = CACTTTAGCGCTTTAAAGGG

Gene: STACA0001_1477: putative sodium-dependent transporter
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -108
score = 5.57261
sequence = CACTTTAGCGCTTTAAAGGG

Gene: SE2326: putative sodium-dependent transporter
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -143
score = 5.72011
sequence = CGCTTTAACGCTTTAAAGTA

Gene: Sca_0085: putative sodium-dependent transporter
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -108
score = 5.87238
sequence = CGCTTTAACGCGTTAAAGGG

Gene: SH2552: putative sodium-dependent transporter
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -47
score = 5.11013
sequence = CGCTTTAACGCAATAAAGCT

Gene: SSP2298: putative sodium-dependent transporter
*
Macrococcus caseolyticus JCSC5402

Site:
position = -33
score = 5.44315
sequence = CACTTTACAGCGTTAAAACG

Gene: MCCL_0041: putative sodium-dependent transporter
putative sodium-dependent transporter
 
CRON 4.
hisZ
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -84
score = 4.74132
sequence = CACTTTAGTGTGGTAGAGAA

Gene: SA2472: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
 
Staphylococcus capitis SK14
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -56
score = 3.91433
sequence = TACTTTAATGTATTATCGAA

Gene: SE0270: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -50
score = 4.86297
sequence = TACTTTAGTTCGGTAGAGAG

Gene: Sca_0637: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
 
Staphylococcus haemolyticus JCSC1435
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -49
score = 4.63863
sequence = TACTTTAGTTCGGTAGAGAA

Gene: SSP0431: ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
 
Macrococcus caseolyticus JCSC5402
ATP phosphoribosyltransferase regulatory subunit (EC 2.4.2.17)
hisG
 
Staphylococcus aureus subsp. aureus N315

Gene: SA2471: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0271: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0636: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP0430: ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
 
Macrococcus caseolyticus JCSC5402
ATP phosphoribosyltransferase catalytic subunit (EC 2.4.2.17)
hisD
 
Staphylococcus aureus subsp. aureus N315

Gene: SA2470: Histidinol dehydrogenase (EC 1.1.1.23)
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0272: Histidinol dehydrogenase (EC 1.1.1.23)
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0635: Histidinol dehydrogenase (EC 1.1.1.23)
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP0429: Histidinol dehydrogenase (EC 1.1.1.23)
 
Macrococcus caseolyticus JCSC5402
Histidinol dehydrogenase (EC 1.1.1.23)
hisC
 
Staphylococcus aureus subsp. aureus N315

Gene: SA2469: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0634: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP0428: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
 
Macrococcus caseolyticus JCSC5402
Histidinol-phosphate aminotransferase (EC 2.6.1.9)
hisB
 
Staphylococcus aureus subsp. aureus N315

Gene: SA2468: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0273: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0633: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP0427: Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
 
Macrococcus caseolyticus JCSC5402
Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
hisH
 
Staphylococcus aureus subsp. aureus N315

Gene: SA2467: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0274: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0632: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP0426: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
 
Macrococcus caseolyticus JCSC5402
Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
hisA
 
Staphylococcus aureus subsp. aureus N315

Gene: SA2466: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0275: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0631: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP0425: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
 
Macrococcus caseolyticus JCSC5402
Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
hisF
 
Staphylococcus aureus subsp. aureus N315

Gene: SA2465: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0276: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0630: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP0424: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
 
Macrococcus caseolyticus JCSC5402
Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
hisIE
 
Staphylococcus aureus subsp. aureus N315

Gene: SA2464: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228

Gene: SE0277: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_0629: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP0423: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
 
Macrococcus caseolyticus JCSC5402
Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD