Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog ScrR - Staphylococcaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Staphylococcus aureus subsp. aureus N315 3 2
Staphylococcus capitis SK14 3 2
Staphylococcus epidermidis ATCC 12228 3 2
Staphylococcus carnosus subsp. carnosus TM300
Staphylococcus haemolyticus JCSC1435 3 2
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 3 2
Macrococcus caseolyticus JCSC5402 3 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
scrB
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -127
score = 5.70743
sequence = ATGTGGAACCGATACCATAT

Gene: SA1846: sucrose-6-phosphate hydrolase
*
Staphylococcus capitis SK14

Site:
position = -207
score = 5.81037
sequence = ATTTGGAACCGATACCACTA

Gene: STACA0001_2125: sucrose-6-phosphate hydrolase
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -233
score = 5.69255
sequence = AAATGGAACCGATACCACAT

Gene: SE1640: sucrose-6-phosphate hydrolase
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_1550: sucrose-6-phosphate hydrolase
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -72
score = 5.72156
sequence = CTATGGAACCGATACCATAA

Gene: SH0991: sucrose-6-phosphate hydrolase
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -58
score = 6.16245
sequence = AAATGGAACCGGTACCAAAA

Gene: SSP0837: sucrose-6-phosphate hydrolase
*
Macrococcus caseolyticus JCSC5402

Site:
position = -30
score = 6.13774
sequence = AAATGGAACCGGTTCCAAAG

Gene: MCCL_0373: sucrose-6-phosphate hydrolase
sucrose-6-phosphate hydrolase
scrK
 
Staphylococcus aureus subsp. aureus N315

Gene: SA1845: fructokinase
 
Staphylococcus capitis SK14

Gene: STACA0001_2126: fructokinase
 
Staphylococcus epidermidis ATCC 12228

Gene: SE1639: fructokinase
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_2175: fructokinase
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0992: fructokinase
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP0838: fructokinase
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0374: fructokinase
fructokinase
scrA2
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0375: non-orthologous PTS system sucrose-specific IIBC component
non-orthologous PTS system sucrose-specific IIBC component
 
CRON 2.
scrA
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -34
score = 5.68631
sequence = AAATGGAACCGGTTCTAATT

Site:
position = -63
score = 6.20238
sequence = TTTTGGAACCGGTTACAATA

Gene: SA2167: PTS system sucrose-specific IIBC component
*
Staphylococcus capitis SK14

Site:
position = -65
score = 5.88124
sequence = TCTTGGAACCGGTTACAATA

Site:
position = -36
score = 5.18902
sequence = AAATGGAACCGGTTTCTAAA

Gene: STACA0001_1097: PTS system sucrose-specific IIBC component
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -60
score = 5.88124
sequence = GATTGGAACCGGTTACAATA

Site:
position = -31
score = 5.04452
sequence = TATTTGAATCGGTTCTAAAA

Gene: SE1959: PTS system sucrose-specific IIBC component
 
Staphylococcus carnosus subsp. carnosus TM300
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -65
score = 6.02553
sequence = TTTTGGAACCGGTTACAATG

Site:
position = -37
score = 5.46057
sequence = AAATAGAACCGGTTCCATTG

Gene: SH0671: PTS system sucrose-specific IIBC component
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -37
score = 6.16245
sequence = TTTTGGTACCGGTTCCATTT

Site:
position = -68
score = 5.6994
sequence = AGTTGGAACCGGTTACAATA

Gene: SSP0512: PTS system sucrose-specific IIBC component
 
Macrococcus caseolyticus JCSC5402
PTS system sucrose-specific IIBC component
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD