Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RbsR2 - Staphylococcaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Staphylococcus aureus subsp. aureus N315 3 1
Staphylococcus capitis SK14
Staphylococcus epidermidis ATCC 12228 3 1
Staphylococcus carnosus subsp. carnosus TM300 3 1
Staphylococcus haemolyticus JCSC1435 6 1
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 5 2
Macrococcus caseolyticus JCSC5402 4 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rbsR2
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
*
Staphylococcus haemolyticus JCSC1435

Site:
position = -33
score = 6.61836
sequence = TCATGTAAGCGGTTACATAA

Gene: SH0174: Transcriptional repressor of ribose utilization RbsR2, LacI family
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -32
score = 6.43357
sequence = ATATGAAAACGGTTACATAA

Gene: SSP1396: Transcriptional repressor of ribose utilization RbsR2, LacI family
*
Macrococcus caseolyticus JCSC5402

Site:
position = -36
score = 6.61836
sequence = TTATGTAATCGGTTACACAA

Gene: MCCL_0348: Transcriptional repressor of ribose utilization RbsR2, LacI family
Transcriptional repressor of ribose utilization RbsR2, LacI family
rbsK
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0175: Ribokinase (EC 2.7.1.15)
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP0744: Ribokinase (EC 2.7.1.15)
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0349: Ribokinase (EC 2.7.1.15)
Ribokinase (EC 2.7.1.15)
rbsD
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0259: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Staphylococcus capitis SK14

Gene: STACA0001_0974: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Staphylococcus epidermidis ATCC 12228

Gene: SE2087: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_2420: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0176: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Site:
position = -35
score = 6.68713
sequence = TTATGTAACGGGTTACATAT

Gene: SSP1395: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Macrococcus caseolyticus JCSC5402
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsA
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0177: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP1394: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
 
Macrococcus caseolyticus JCSC5402
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
rbsC
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0178: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP1393: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
 
Macrococcus caseolyticus JCSC5402
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
rbsB
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0179: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP1392: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
 
Macrococcus caseolyticus JCSC5402
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
MCCL_0350
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0350: hypothetical protein
hypothetical protein
MCCL_0351
 
Staphylococcus aureus subsp. aureus N315
 
Staphylococcus capitis SK14
 
Staphylococcus epidermidis ATCC 12228
 
Staphylococcus carnosus subsp. carnosus TM300
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402

Gene: MCCL_0351: hypothetical protein
hypothetical protein
rbsU
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -88
score = 4.52793
sequence = TTATGAAAACGCATGCATTT

Gene: SA0260: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5)
 
Staphylococcus capitis SK14

Gene: STACA0001_0973: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5)
*
Staphylococcus epidermidis ATCC 12228

Site:
position = -270
score = 4.71616
sequence = GTAGGTAACCGTTAAAATAA

Gene: SE2088: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5)
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -103
score = 5.42855
sequence = ATATGAAAGCGTATACATAT

Gene: Sca_2421: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5)
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402
Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5)
rbsK
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0258: Ribokinase (EC 2.7.1.15)
 
Staphylococcus capitis SK14

Gene: STACA0001_0975: Ribokinase (EC 2.7.1.15)
 
Staphylococcus epidermidis ATCC 12228

Gene: SE2086: Ribokinase (EC 2.7.1.15)
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_2419: Ribokinase (EC 2.7.1.15)
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402
Ribokinase (EC 2.7.1.15)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD