Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog RbsR - Staphylococcaceae

Properties
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Staphylococcus aureus subsp. aureus N315 3 1
Staphylococcus capitis SK14
Staphylococcus epidermidis ATCC 12228
Staphylococcus carnosus subsp. carnosus TM300 3 1
Staphylococcus haemolyticus JCSC1435
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
Macrococcus caseolyticus JCSC5402
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
rbsU
*
Staphylococcus aureus subsp. aureus N315

Site:
position = -43
score = 7.42686
sequence = TTGGTAAAACGTTTTACTAA

Gene: SA0260: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5)
 
Staphylococcus capitis SK14

Gene: STACA0001_0973: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5)
 
Staphylococcus epidermidis ATCC 12228

Gene: SE2088: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5)
*
Staphylococcus carnosus subsp. carnosus TM300

Site:
position = -63
score = 7.60951
sequence = TTAGTAAAACGTTTTACTAA

Gene: Sca_2421: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5)
 
Staphylococcus haemolyticus JCSC1435
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402
Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5)
rbsD
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0259: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Staphylococcus capitis SK14

Gene: STACA0001_0974: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Staphylococcus epidermidis ATCC 12228

Gene: SE2087: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_2420: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0176: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Gene: SSP1395: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
 
Macrococcus caseolyticus JCSC5402
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
rbsK
 
Staphylococcus aureus subsp. aureus N315

Gene: SA0258: Ribokinase (EC 2.7.1.15)
 
Staphylococcus capitis SK14

Gene: STACA0001_0975: Ribokinase (EC 2.7.1.15)
 
Staphylococcus epidermidis ATCC 12228

Gene: SE2086: Ribokinase (EC 2.7.1.15)
 
Staphylococcus carnosus subsp. carnosus TM300

Gene: Sca_2419: Ribokinase (EC 2.7.1.15)
 
Staphylococcus haemolyticus JCSC1435

Gene: SH0175: Ribokinase (EC 2.7.1.15)
 
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305
 
Macrococcus caseolyticus JCSC5402
Ribokinase (EC 2.7.1.15)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD