Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog CymR - Clostridia-1

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Cysteine metabolism
Effector:
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 16 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Clostridium acetobutylicum ATCC 824 20 6
Clostridium beijerincki NCIMB 8052 5 4
Clostridium botulinum A str. ATCC 3502 4 2
Clostridium butyricum 5521 9 2
Clostridium kluyveri DSM 555
Clostridium novyi NT
Clostridium perfringens ATCC 13124
Clostridium tetani E88 1 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
sbpA
 
Clostridium acetobutylicum ATCC 824
*2
Clostridium beijerincki NCIMB 8052

Site:
position = -98
score = 5.80464
sequence = AAAATCCTACTAAACATATATGAATAT

Gene: Cbei_4193: Sulfate-binding protein Sbp

Site:
position = -170
score = 5.29586
sequence = TAATTCCCATTGAAATAATAGGAATTA

Gene: Cbei_4194: Sulfate-binding protein Sbp
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Sulfate-binding protein Sbp
 
CRON 2.
metY
*
Clostridium acetobutylicum ATCC 824

Site:
position = -77
score = 5.04179
sequence = CATTACATAGTAAAGTAATATGTTTTA

Site:
position = -277
score = 5.70855
sequence = ATATTCATATTAATATAGTAGGAATTA

Gene: CAC0102: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) / O-succinylhomoserine sulfhydrylase (EC 2.5.1.48)
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) / O-succinylhomoserine sulfhydrylase (EC 2.5.1.48)
cysC
 
Clostridium acetobutylicum ATCC 824

Gene: CAC0103: Adenylylsulfate kinase (EC 2.7.1.25)
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555

Gene: CKL_1799: Adenylylsulfate kinase (EC 2.7.1.25)
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Adenylylsulfate kinase (EC 2.7.1.25)
aprA
 
Clostridium acetobutylicum ATCC 824

Gene: CAC0104: Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4189: Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_3242: Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
 
Clostridium kluyveri DSM 555

Gene: CKL_1798: Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
aprB
 
Clostridium acetobutylicum ATCC 824

Gene: CAC0105: Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_3243: Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
 
Clostridium kluyveri DSM 555

Gene: CKL_1797: Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
CAC0106
 
Clostridium acetobutylicum ATCC 824

Gene: CAC0106: ABC-type probable sulfate transporter, periplasmic binding protein
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
ABC-type probable sulfate transporter, periplasmic binding protein
CAC0107
 
Clostridium acetobutylicum ATCC 824

Gene: CAC0107: ABC-type probable sulfate transporter, ATPase component
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
ABC-type probable sulfate transporter, ATPase component
CAC0108
 
Clostridium acetobutylicum ATCC 824

Gene: CAC0108: ABC-type nitrate/sulfonate/bicarbonate transport system, permease component
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
ABC-type nitrate/sulfonate/bicarbonate transport system, permease component
cysD
 
Clostridium acetobutylicum ATCC 824

Gene: CAC0109: Sulfate adenylyltransferase subunit 2 (EC 2.7.7.4)
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555

Gene: CKL_1796: Sulfate adenylyltransferase subunit 2 (EC 2.7.7.4)
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Sulfate adenylyltransferase subunit 2 (EC 2.7.7.4)
cysN
 
Clostridium acetobutylicum ATCC 824

Gene: CAC0110: Sulfate adenylyltransferase subunit 1 (EC 2.7.7.4)
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555

Gene: CKL_1795: Sulfate adenylyltransferase subunit 1 (EC 2.7.7.4)
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Sulfate adenylyltransferase subunit 1 (EC 2.7.7.4)
cysT
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4192: Sulfate transport system permease protein CysT
 
Clostridium botulinum A str. ATCC 3502
*
Clostridium butyricum 5521

Site:
position = -81
score = 5.59672
sequence = TAATTCATAGTAATTCTATAAGAATAA

Gene: CBY_3239: Sulfate transport system permease protein CysT
 
Clostridium kluyveri DSM 555

Gene: CKL_1802: Sulfate transport system permease protein CysT
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Sulfate transport system permease protein CysT
cysW
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4191: Sulfate transport system permease protein CysW
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_3240: Sulfate transport system permease protein CysW
 
Clostridium kluyveri DSM 555

Gene: CKL_1801: Sulfate transport system permease protein CysW
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Sulfate transport system permease protein CysW
cysA
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4190: Sulfate and thiosulfate import ATP-binding protein CysA (EC 3.6.3.25)
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_3241: Sulfate and thiosulfate import ATP-binding protein CysA (EC 3.6.3.25)
 
Clostridium kluyveri DSM 555

Gene: CKL_1800: Sulfate and thiosulfate import ATP-binding protein CysA (EC 3.6.3.25)
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Sulfate and thiosulfate import ATP-binding protein CysA (EC 3.6.3.25)
cysD
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4187: Sulfate adenylyltransferase subunit 2 (EC 2.7.7.4)
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_3244: sulfate adenylyltransferase, small subunit
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Sulfate adenylyltransferase subunit 2 (EC 2.7.7.4)
cysN
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_4186: Sulfate adenylyltransferase subunit 1 (EC 2.7.7.4)
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521

Gene: CBY_3245: Sulfate adenylyltransferase subunit 1 (EC 2.7.7.4)
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Sulfate adenylyltransferase subunit 1 (EC 2.7.7.4)
 
CRON 3.
tcyP
 
Clostridium acetobutylicum ATCC 824
*
Clostridium beijerincki NCIMB 8052

Site:
position = -48
score = 5.29715
sequence = ATAAATATACTAATTATATAGGAATTG

Gene: Cbei_4344: L-cystine uptake protein TcyP
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124

Gene: CPF_1191: L-cystine uptake protein TcyP
 
Clostridium tetani E88
L-cystine uptake protein TcyP
 
CRON 4.
CAC3325
*
Clostridium acetobutylicum ATCC 824

Site:
position = -354
score = 5.58509
sequence = GTATACCTACTTGTATACTAGGAATAT

Gene: CAC3325: L-Cystine ABC transporter, periplasmic cystine-binding protein TcyA
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
L-Cystine ABC transporter, periplasmic cystine-binding protein TcyA
CAC3326
 
Clostridium acetobutylicum ATCC 824

Gene: CAC3326: L-Cystine ABC transporter, permease protein TcyB
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
L-Cystine ABC transporter, permease protein TcyB
CAC3327
 
Clostridium acetobutylicum ATCC 824

Gene: CAC3327: L-Cystine ABC transporter, ATP-binding protein TcyC
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
L-Cystine ABC transporter, ATP-binding protein TcyC
 
CRON 5.
cysK
*
Clostridium acetobutylicum ATCC 824

Site:
position = -49
score = 5.83312
sequence = ATATTCCTAGTAAACAAATGTGTTTAA

Gene: CAC2235: Cysteine synthase (EC 2.5.1.47)
 
Clostridium beijerincki NCIMB 8052
*
Clostridium botulinum A str. ATCC 3502

Site:
position = -303
score = 5.93953
sequence = GAATACCTAGTAAACAAATAAGAATAA

Gene: CBO1179: Cysteine synthase (EC 2.5.1.47)
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT

Gene: NT01CX_0572: Cysteine synthase (EC 2.5.1.47)
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88

Gene: CTC01343: Cysteine synthase (EC 2.5.1.47)
Cysteine synthase (EC 2.5.1.47)
CAC0878
*
Clostridium acetobutylicum ATCC 824

Site:
position = -70
score = 5.77605
sequence = TTAAACATATTAGTTTAGTAGGTATTT

Gene: CAC0878: Cysteine ABC transporter permease component
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO1180: Cysteine ABC transporter permease component
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Cysteine ABC transporter permease component
CAC0880
 
Clostridium acetobutylicum ATCC 824

Gene: CAC0880: Cysteine ABC transporter, substrate-binding protein
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO1181: Cysteine ABC transporter, substrate-binding protein
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Cysteine ABC transporter, substrate-binding protein
CAC0879
 
Clostridium acetobutylicum ATCC 824

Gene: CAC0879: Cysteine ABC transporter, ATPase component
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Cysteine ABC transporter, ATPase component
 
CRON 6.
ubiG
*
Clostridium acetobutylicum ATCC 824

Site:
position = -473
score = 5.36547
sequence = AAAAACCTACTTATCAGATATGAAAAA

Gene: CAC0929: SAM-dependent methlytransferase UbiG
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO0727: SAM-dependent methlytransferase UbiG
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555

Gene: CKL_1001: SAM-dependent methlytransferase UbiG
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124

Gene: CPF_0168: SAM-dependent methlytransferase UbiG
 
Clostridium tetani E88
SAM-dependent methlytransferase UbiG
mccB
 
Clostridium acetobutylicum ATCC 824

Gene: CAC0930: Cystathionine gamma-lyase (EC 4.4.1.1)
*
Clostridium beijerincki NCIMB 8052

Site:
position = -140
score = 5.67029
sequence = TAAAACACAGTAAACAAATAAGAATAA

Gene: Cbei_0629: Cystathionine gamma-lyase (EC 4.4.1.1)
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO0726: Cystathionine gamma-lyase (EC 4.4.1.1)
*
Clostridium butyricum 5521

Site:
position = -100
score = 5.52502
sequence = TAATTCCAAGTAAACAAATAGTAATAG

Gene: CBY_1162: Cystathionine gamma-lyase (EC 4.4.1.1)
 
Clostridium kluyveri DSM 555

Gene: CKL_1002: Cystathionine gamma-lyase (EC 4.4.1.1)
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124

Gene: CPF_0169: Cystathionine gamma-lyase (EC 4.4.1.1)
 
Clostridium tetani E88
Cystathionine gamma-lyase (EC 4.4.1.1)
CAC0931
 
Clostridium acetobutylicum ATCC 824

Gene: CAC0931: Cystathionine beta-synthase (EC 4.2.1.22)
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_0630: Cystathionine beta-synthase (EC 4.2.1.22)
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124

Gene: CPF_0170: Cystathionine beta-synthase (EC 4.2.1.22)
 
Clostridium tetani E88
Cystathionine beta-synthase (EC 4.2.1.22)
mccA
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO0724: Cystathionine beta-synthase (EC 4.2.1.22)
 
Clostridium butyricum 5521

Gene: CBY_1163: Cystathionine beta-synthase (EC 4.2.1.22)
 
Clostridium kluyveri DSM 555

Gene: CKL_1003: Cystathionine beta-synthase (EC 4.2.1.22)
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Cystathionine beta-synthase (EC 4.2.1.22)
 
CRON 7.
cymR
*
Clostridium acetobutylicum ATCC 824

Site:
position = -86
score = 5.30689
sequence = AAAATTCTACTTGACAAGTAAAATTTT

Gene: CAC2236: Predicted transcriptional regulator of cysteine synthase, Rrf2 family
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_1748: Predicted transcriptional regulator of cysteine synthase, Rrf2 family
*
Clostridium botulinum A str. ATCC 3502

Site:
position = -45
score = 5.74509
sequence = ATAATCATAGTAAATAGATAGGAATAC

Gene: CBO1178: Predicted transcriptional regulator of cysteine synthase, Rrf2 family
 
Clostridium butyricum 5521

Gene: CBY_1066: Predicted transcriptional regulator of cysteine synthase, Rrf2 family
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
*
Clostridium tetani E88

Site:
position = -40
score = 5.77564
sequence = ATAATCATACTAAACATATAGGAATAG

Gene: CTC01344: Predicted transcriptional regulator of cysteine synthase, Rrf2 family
Predicted transcriptional regulator of cysteine synthase, Rrf2 family
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD