Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IscR - Clostridia-3

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 9 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Bacteroides pectinophilus ATCC 43243
Blautia hansenii DSM 20583 4 1
Bryantella formatexigens DSM 14469 4 1
Clostridiales bacterium 1_7_47_FAA
Clostridium bolteae ATCC BAA-613
Clostridium nexile DSM 1787 4 1
Clostridium scindens ATCC 35704 4 1
Dorea formicigenerans ATCC 27755 4 1
Dorea longicatena DSM 13814 5 1
Eubacterium eligens ATCC 27750
Eubacterium rectale ATCC 33656 4 1
Roseburia intestinalis L1-82
Ruminococcus gnavus ATCC 29149 4 1
Ruminococcus lactaris ATCC 29176 4 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
iscR
 
Bacteroides pectinophilus ATCC 43243
*
Blautia hansenii DSM 20583

Site:
position = -43
score = 5.57175
sequence = AGAAATCAGAGTAAAACAGTCGGAATTGA

Gene: BLAHAN_03017: Iron-sulfur cluster assembly transcription factor IscR
*
Bryantella formatexigens DSM 14469

Site:
position = -53
score = 6.20065
sequence = AGAAATCCGAGTAATTTAGTAGGATTTAA

Gene: BRYFOR_01246: Iron-sulfur cluster assembly transcription factor IscR
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
*
Clostridium nexile DSM 1787

Site:
position = -51
score = 5.91229
sequence = ATAAACCCTAGTAATTCACTAGGAATTAA

Gene: CLONEX_03012: Iron-sulfur cluster assembly transcription factor IscR
*
Clostridium scindens ATCC 35704

Site:
position = 18
score = 5.74359
sequence = AGAAATCCTAGCAAATTGCTAGGAATTAA

Gene: CLOSCI_01399: Iron-sulfur cluster assembly transcription factor IscR
*
Dorea formicigenerans ATCC 27755

Site:
position = -37
score = 4.69748
sequence = TAAATCCCCAGTATTTTGCTAGGGATTGG

Gene: DORFOR_01426: Iron-sulfur cluster assembly transcription factor IscR
*
Dorea longicatena DSM 13814

Site:
position = -43
score = 5.39194
sequence = AAAAATCCTAGTAAAATACTGGGGATTAA

Gene: DORLON_02444: Iron-sulfur cluster assembly transcription factor IscR
 
Eubacterium eligens ATCC 27750
*
Eubacterium rectale ATCC 33656

Site:
position = -45
score = 5.32536
sequence = TGAATGTATAGTAAAGCAGTAGGAAATGA

Gene: EUBREC_0307: Iron-sulfur cluster assembly transcription factor IscR
 
Roseburia intestinalis L1-82
*
Ruminococcus gnavus ATCC 29149

Site:
position = -60
score = 4.49887
sequence = GGAAATCCTAGTAAAACAATAGGGATTGG

Gene: RUMGNA_01751: Iron-sulfur cluster assembly transcription factor IscR
*
Ruminococcus lactaris ATCC 29176

Site:
position = -54
score = 4.58676
sequence = GAAAATCCTAGTACAATACTAGGGATAAT

Gene: RUMLAC_01913: Iron-sulfur cluster assembly transcription factor IscR
Iron-sulfur cluster assembly transcription factor IscR
DORLON_02443
 
Bacteroides pectinophilus ATCC 43243
 
Blautia hansenii DSM 20583
 
Bryantella formatexigens DSM 14469
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787
 
Clostridium scindens ATCC 35704
 
Dorea formicigenerans ATCC 27755
 
Dorea longicatena DSM 13814

Gene: DORLON_02443: hypothetical protein
 
Eubacterium eligens ATCC 27750
 
Eubacterium rectale ATCC 33656
 
Roseburia intestinalis L1-82
 
Ruminococcus gnavus ATCC 29149
 
Ruminococcus lactaris ATCC 29176
hypothetical protein
iscS
 
Bacteroides pectinophilus ATCC 43243
 
Blautia hansenii DSM 20583

Gene: BLAHAN_03016: Cysteine desulfurase (EC 2.8.1.7)
 
Bryantella formatexigens DSM 14469

Gene: BRYFOR_01247: Cysteine desulfurase (EC 2.8.1.7)
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787

Gene: CLONEX_03011: Cysteine desulfurase (EC 2.8.1.7)
 
Clostridium scindens ATCC 35704

Gene: CLOSCI_01400: Cysteine desulfurase (EC 2.8.1.7)
 
Dorea formicigenerans ATCC 27755

Gene: DORFOR_01427: Cysteine desulfurase (EC 2.8.1.7)
 
Dorea longicatena DSM 13814

Gene: DORLON_02442: Cysteine desulfurase (EC 2.8.1.7)
 
Eubacterium eligens ATCC 27750
 
Eubacterium rectale ATCC 33656

Gene: EUBREC_0308: Cysteine desulfurase (EC 2.8.1.7)
 
Roseburia intestinalis L1-82
 
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_01752: Cysteine desulfurase (EC 2.8.1.7)
 
Ruminococcus lactaris ATCC 29176

Gene: RUMLAC_01914: Cysteine desulfurase (EC 2.8.1.7)
Cysteine desulfurase (EC 2.8.1.7)
iscU
 
Bacteroides pectinophilus ATCC 43243
 
Blautia hansenii DSM 20583

Gene: BLAHAN_03015: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
 
Bryantella formatexigens DSM 14469

Gene: BRYFOR_01248: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787

Gene: CLONEX_03010: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
 
Clostridium scindens ATCC 35704

Gene: CLOSCI_01401: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
 
Dorea formicigenerans ATCC 27755

Gene: DORFOR_01428: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
 
Dorea longicatena DSM 13814

Gene: DORLON_02441: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
 
Eubacterium eligens ATCC 27750
 
Eubacterium rectale ATCC 33656

Gene: EUBREC_0309: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
 
Roseburia intestinalis L1-82
 
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_01753: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
 
Ruminococcus lactaris ATCC 29176

Gene: RUMLAC_01915: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
trmU
 
Bacteroides pectinophilus ATCC 43243
 
Blautia hansenii DSM 20583

Gene: BLAHAN_03014: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
 
Bryantella formatexigens DSM 14469

Gene: BRYFOR_01249: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
 
Clostridiales bacterium 1_7_47_FAA
 
Clostridium bolteae ATCC BAA-613
 
Clostridium nexile DSM 1787

Gene: CLONEX_03009: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
 
Clostridium scindens ATCC 35704

Gene: CLOSCI_01402: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
 
Dorea formicigenerans ATCC 27755

Gene: DORFOR_01429: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
 
Dorea longicatena DSM 13814

Gene: DORLON_02440: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
 
Eubacterium eligens ATCC 27750
 
Eubacterium rectale ATCC 33656

Gene: EUBREC_0310: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
 
Roseburia intestinalis L1-82
 
Ruminococcus gnavus ATCC 29149

Gene: RUMGNA_01754: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
 
Ruminococcus lactaris ATCC 29176

Gene: RUMLAC_01916: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD