Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IscR - Clostridia-2

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Clostridium bartlettii DSM 16795 4 1
Clostridium difficile 630 3 1
Clostridium hiranonis DSM 13275 4 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
iscR
*
Clostridium bartlettii DSM 16795

Site:
position = -88
score = 5.73843
sequence = TTAATGTTGACAAAAACACTCAAGTATAA

Site:
position = -113
score = 6.62147
sequence = TTAATTCTGACTAAAATAGTCAAAATTAA

Gene: CLOBAR_02189: Iron-sulfur cluster assembly transcription factor IscR
*
Clostridium difficile 630

Site:
position = -53
score = 5.38793
sequence = GTAATTCCTACTAAAACAGTATGAATTAG

Site:
position = -98
score = 5.95584
sequence = TTAATCTTGACAAAATTAGTAGGGTATAA

Gene: CD1278: Iron-sulfur cluster assembly transcription factor IscR
*
Clostridium hiranonis DSM 13275

Site:
position = -43
score = 6.01591
sequence = TTAAACCATAGTAAAACAGTAGGAATTAA

Site:
position = -77
score = 5.65314
sequence = TAATACTTGACAAAAATAGTCGGATATAA

Site:
position = -103
score = 5.88657
sequence = ACAAATCATACTAAAATAGTAGGAAATAA

Gene: CLOHIR_01195: Iron-sulfur cluster assembly transcription factor IscR
Iron-sulfur cluster assembly transcription factor IscR
iscS
 
Clostridium bartlettii DSM 16795

Gene: CLOBAR_02188: Cysteine desulfurase (EC 2.8.1.7)
 
Clostridium difficile 630

Gene: CD1279: Cysteine desulfurase (EC 2.8.1.7)
 
Clostridium hiranonis DSM 13275

Gene: CLOHIR_01196: Cysteine desulfurase (EC 2.8.1.7)
Cysteine desulfurase (EC 2.8.1.7)
iscU
 
Clostridium bartlettii DSM 16795

Gene: CLOBAR_02187: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
 
Clostridium difficile 630

Gene: CD1280: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
 
Clostridium hiranonis DSM 13275

Gene: CLOHIR_01197: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
trmU
 
Clostridium bartlettii DSM 16795

Gene: CLOBAR_02186: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
 
Clostridium difficile 630

Gene: CD1281: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
 
Clostridium hiranonis DSM 13275

Gene: CLOHIR_01198: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD