Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulog IscR - Clostridia-1

Properties
Regulator type: Transcription factor
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Phylum: Firmicutes
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Clostridium acetobutylicum ATCC 824 6 2
Clostridium beijerincki NCIMB 8052 5 2
Clostridium botulinum A str. ATCC 3502 3 1
Clostridium butyricum 5521 4 1
Clostridium kluyveri DSM 555 8 2
Clostridium novyi NT 4 1
Clostridium perfringens ATCC 13124 8 4
Clostridium tetani E88 4 1
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
hesB
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
*
Clostridium perfringens ATCC 13124

Site:
position = -76
score = 4.76628
sequence = TTTATTTTGTTTAAAATTATATAATTTAA

Site:
position = -101
score = 5.28721
sequence = TAAATTCCTACTAAAATAGTCTTGATTTA

Gene: CPF_0654: HesB family protein
 
Clostridium tetani E88
HesB family protein
 
CRON 2.
yxeON
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
*
Clostridium perfringens ATCC 13124

Site:
position = -69
score = 5.34994
sequence = TCAAAGTTGACAATTTTGATGGGAATTAA

Gene: CPF_2350: Cysteine ABC transporter, substrate-binding protein fused to permease component
 
Clostridium tetani E88
Cysteine ABC transporter, substrate-binding protein fused to permease component
yxeM
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124

Gene: CPF_2349: Amino acid ABC transporter, ATP-binding protein
 
Clostridium tetani E88
Amino acid ABC transporter, ATP-binding protein
 
CRON 3.
ldh
 
Clostridium acetobutylicum ATCC 824

Gene: CAC0267: L-lactate dehydrogenase (EC 1.1.1.27)
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_1014: L-lactate dehydrogenase (EC 1.1.1.27)
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO1519: L-lactate dehydrogenase (EC 1.1.1.27)
 
Clostridium butyricum 5521

Gene: CBY_2757: L-lactate dehydrogenase (EC 1.1.1.27)
 
Clostridium kluyveri DSM 555

Gene: CKL_1381: L-lactate dehydrogenase (EC 1.1.1.27)
 
Clostridium novyi NT

Gene: NT01CX_0236: L-lactate dehydrogenase (EC 1.1.1.27)
*
Clostridium perfringens ATCC 13124

Site:
position = -46
score = 5.54367
sequence = ATAATTCAGAGTAATTAACTAGGAATTAG

Gene: CPF_0098: L-lactate dehydrogenase (EC 1.1.1.27)
 
Clostridium tetani E88

Gene: CTC01998: L-lactate dehydrogenase (EC 1.1.1.27)
L-lactate dehydrogenase (EC 1.1.1.27)
 
CRON 4.
sufC
*
Clostridium acetobutylicum ATCC 824

Site:
position = -58
score = 5.41844
sequence = TGAATTCCGACTTAAATGGTCAAGATTAA

Gene: CAC3288: Iron-sulfur cluster assembly ATPase protein SufC
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_1848: Iron-sulfur cluster assembly ATPase protein SufC
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
*
Clostridium kluyveri DSM 555

Site:
position = -41
score = 5.71541
sequence = TTAAATATGAGTCAAATACTCGGATTTAA

Gene: CKL_0828: Iron-sulfur cluster assembly ATPase protein SufC
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Iron-sulfur cluster assembly ATPase protein SufC
sufB
 
Clostridium acetobutylicum ATCC 824

Gene: CAC3289: Iron-sulfur cluster assembly protein SufB
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_1849: Iron-sulfur cluster assembly protein SufB
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555

Gene: CKL_0829: Iron-sulfur cluster assembly protein SufB
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Iron-sulfur cluster assembly protein SufB
sufD
 
Clostridium acetobutylicum ATCC 824

Gene: CAC3290: Iron-sulfur cluster assembly protein SufD
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_1850: Iron-sulfur cluster assembly protein SufD
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555

Gene: CKL_0830: Iron-sulfur cluster assembly protein SufD
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Iron-sulfur cluster assembly protein SufD
sufS
 
Clostridium acetobutylicum ATCC 824

Gene: CAC3291: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_1851: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555

Gene: CKL_0831: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
sufE
 
Clostridium acetobutylicum ATCC 824

Gene: CAC3292: Putative iron-sulfur cluster assembly scaffold protein for SUF system
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_1852: Putative iron-sulfur cluster assembly scaffold protein for SUF system
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555

Gene: CKL_0832: Putative iron-sulfur cluster assembly scaffold protein for SUF system
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Putative iron-sulfur cluster assembly scaffold protein for SUF system
 
CRON 5.
cysK
 
Clostridium acetobutylicum ATCC 824
*
Clostridium beijerincki NCIMB 8052

Site:
position = -55
score = 5.18973
sequence = TTATAACATAGTAAACTGATAAGAATTAT

Gene: Cbei_4356: Cysteine synthase (EC 2.5.1.47)
 
Clostridium botulinum A str. ATCC 3502
 
Clostridium butyricum 5521
 
Clostridium kluyveri DSM 555
 
Clostridium novyi NT
 
Clostridium perfringens ATCC 13124
 
Clostridium tetani E88
Cysteine synthase (EC 2.5.1.47)
 
CRON 6.
iscR
*
Clostridium acetobutylicum ATCC 824

Site:
position = -41
score = 5.77827
sequence = ACAAAGTAGAGTATTATTGTCGGAATTAA

Gene: CAC1675: Iron-sulfur cluster assembly transcription factor IscR
*
Clostridium beijerincki NCIMB 8052

Site:
position = -105
score = 5.67628
sequence = CAAAAGCCGAGTATTTTGGTAAGATATAA

Gene: Cbei_1097: Iron-sulfur cluster assembly transcription factor IscR
*
Clostridium botulinum A str. ATCC 3502

Site:
position = -43
score = 6.02153
sequence = ATAAATCATAGTAAAGTGGTCAACATTAA

Site:
position = -82
score = 4.78731
sequence = ATATTGTTGACAGGTTTAGTCTGATTTGC

Gene: CBO2569: Iron-sulfur cluster assembly transcription factor IscR
*
Clostridium butyricum 5521

Site:
position = -61
score = 5.25534
sequence = CAATAGCCGAGTATTTTGATAAGATATAA

Gene: CBY_2622: Iron-sulfur cluster assembly transcription factor IscR
*
Clostridium kluyveri DSM 555

Site:
position = -71
score = 5.76577
sequence = TTATTGTTGACAAGTTTACTCTGATTTGA

Gene: CKL_1317: Iron-sulfur cluster assembly transcription factor IscR
*
Clostridium novyi NT

Site:
position = -41
score = 5.60115
sequence = AGAATTCATAGTATAACACTCGGATTTAA

Site:
position = -82
score = 5.91078
sequence = TTAATGTTGACAAAAACACTCGGATTTGA

Gene: NT01CX_2284: Iron-sulfur cluster assembly transcription factor IscR
*
Clostridium perfringens ATCC 13124

Site:
position = -80
score = 5.82798
sequence = TTATTGTTGACAAATTTACTCGGTTTTGA

Site:
position = -39
score = 5.03984
sequence = ATAAAGTACATCGAATTAGTCAGATTTAG

Gene: CPF_2040: Iron-sulfur cluster assembly transcription factor IscR
*
Clostridium tetani E88

Site:
position = -52
score = 5.49248
sequence = TGAAAGTTTAGTAAAGCAGTAGACTTTCA

Site:
position = -92
score = 5.21816
sequence = TTATAGTTGACAGGAATACTCGGATTTGT

Gene: CTC01049: Iron-sulfur cluster assembly transcription factor IscR
Iron-sulfur cluster assembly transcription factor IscR
iscS
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_1098: Cysteine desulfurase (EC 2.8.1.7)
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO2568: Cysteine desulfurase (EC 2.8.1.7)
 
Clostridium butyricum 5521

Gene: CBY_2621: Cysteine desulfurase (EC 2.8.1.7)
 
Clostridium kluyveri DSM 555

Gene: CKL_1318: Cysteine desulfurase (EC 2.8.1.7)
 
Clostridium novyi NT

Gene: NT01CX_2283: Cysteine desulfurase (EC 2.8.1.7)
 
Clostridium perfringens ATCC 13124

Gene: CPF_2039: Cysteine desulfurase (EC 2.8.1.7)
 
Clostridium tetani E88

Gene: CTC01050: Cysteine desulfurase (EC 2.8.1.7)
Cysteine desulfurase (EC 2.8.1.7)
iscU
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_1099: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO2567: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
 
Clostridium butyricum 5521

Gene: CBY_2620: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
 
Clostridium kluyveri DSM 555

Gene: CKL_1319: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
 
Clostridium novyi NT

Gene: NT01CX_2282: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
 
Clostridium perfringens ATCC 13124

Gene: CPF_2038: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
 
Clostridium tetani E88

Gene: CTC01051: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
trmU
 
Clostridium acetobutylicum ATCC 824
 
Clostridium beijerincki NCIMB 8052

Gene: Cbei_1100: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
 
Clostridium botulinum A str. ATCC 3502

Gene: CBO2905: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
 
Clostridium butyricum 5521

Gene: CBY_2619: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
 
Clostridium kluyveri DSM 555

Gene: CKL_1088: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
 
Clostridium novyi NT

Gene: NT01CX_2281: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
 
Clostridium perfringens ATCC 13124

Gene: CPF_2037: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
 
Clostridium tetani E88

Gene: CTC01052: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD